INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

THE MAMMALIAN RENAL TUBULE is a highly differentiated epithelium that plays a critical role in body fluid homeostasis (2, 16, 38). In vivo micropuncture and in vitro tubule perfusion experiments helped define segment-specific expression and regulation of ion transport functions in the renal nephron (8, 13, 20). Nonrenal epithelia (e.g., frog skin, urinary bladder, gallbladder) have been exploited as simple model systems that exhibit specific features of the renal epithelium (36). Recently, primary cell culture (5, 14, 21, 31) and immortalized renal cell lines (1, 7, 24, 25, 27, 28, 37, 39, 43) have provided additional insight into renal epithelial function. The renal collecting tubule (CT) is composed of at least two cell types (principal and intercalated) and is characterized by an amiloride-sensitive, aldosterone-regulated electrogenic Na⁺ absorption, K⁺ secretion, cAMP-regulated water permeability, and the capacity for either acid or base secretion. Several approaches have been used to generate CT cell lines that retain some of these properties.

Early attempts to generate immortalized renal epithelial cell lines included conferring constitutive expression of large T antigen by in vitro transfection of isolated cells. Two cell lines, RCCT-28A (1) and RC.SV (42), derived from primary cultures of rabbit CT cells transfected with the early region of SV40 were shown to be responsive to receptor agonists [vasopressin (VP), isoproterenol, PGE₂] known to mediate CT function. However, in RC.SV cells, these markers were found to be reduced following long-term culture. Furthermore, the cell lines expressed features of both proximal and distal tubule cells. Since neither cell line formed electrically resistive barriers, transepithelial transport function was not evaluated. Recently, a VP-sensitive cortical collecting duct cell line, RCCD, was developed by in vitro transfection of rat CT cells with wild-type SV40 large T antigen (7). The cells formed monolayers and developed a high transepithelial resistance (R_T) and exhibited VP-activated short-circuit current (I_sc). In an effort to develop a more differentiated renal cell line, Prie et al. (35) transfected rabbit CT cells with a temperature-sensitive mutant of the SV40 large T immortalizing oncogene. The cell line was grown at the permissive temperature and induced to differentiate by a switch to the nonpermissive temperature. Differences in growth, effector-stimulated cAMP production and VP binding consistent with differentiated CT cell function were observed in cultures maintained under nonpermissive conditions; however, no ion transport data were reported (34, 35, 37).

Another approach to generate immortalized epithelial cell lines is the use of in vivo systems as a source for cells with stable, endogenous levels of immortalizing oncogenes to avoid the unpredictable characteristics of in vitro transfection. Two renal epithelial cell model systems have been developed from the CT of mice transgenic for the early region of wild-type SV40 [Tg(SV40E)Bri/7]. A cortical CT cell line (M-1) that exhibits amiloride-sensitive Na⁺ absorption and is responsive to arginine vasopressin (AVP) was developed by Stoos et al. (39). Stanton and coworkers (24) used a similar approach to isolate an inner medullary collecting duct cell line (mIMCDK-2). Electrophysiological measurements revealed amiloride-sensitive Na⁺ absorption and cAMP-dependent Cl conductance in both cell lines (24, 27).

The advantages of endogenous (transgene) and controlled (temperature sensitive) expression of large T antigen were recently combined in studies of Cluzeaud et al. (11). They developed several renal cell lines from a transgenic mouse (pHu-Vim-878-Tst t) that carries the temperature-sensitive mutant of SV40 large T antigen controlled by the mesenchymal tissue-specific vimentin promoter. Temperature-induced differentiation of cytoskeletal element expression, segment-specific hormone responsiveness, and enhanced Na⁺-K⁺-ATPase transport activity were observed in renal cells grown at the nonpermissive temperature. However, the effect of nonpermissive conditions on transepithelial ion transport was not evaluated in these cell lines. Jat et al. (22) produced a transgenic mouse line (H2K^b-tsA58; ImmortoMouse) that carries the thermolabile mutant of SV40 large T antigen under the control of a ubiquitous interferon- (IFN-)-inducible promoter, H2K^b. Several conditionally immortalized cell lines that show tissue-specific differentiation induced by nonpermissive growth conditions were subsequently developed from this mouse line (10, 30, 41).

The goal of this work was to develop (from the ImmortoMouse) a conditionally immortalized CT cell line suitable for studies of transepithelial ion transport. The resulting cell line, mCT1, has properties of native CT cells and, when exposed to nonpermissive conditions, exhibits changes in large T antigen levels and cell proliferation.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Animals. A homozygous male ImmortoMouse (Charles River Laboratories) was bred with a wild-type female mouse, and the offspring were genotyped by PCR analysis of DNA extracts from tail sections. Sections of ~1 cm in length were digested overnight at 55°C with 700 µl proteinase K (Fisher) (10 mg/ml NTES buffer: 100 mM NaCl, 50 mM Tris, pH 8.0, 50 mM EDTA, and 1% SDS). DNA was extracted from the digests by the phenol method, and spooled DNA was rinsed with 70% EtOH and dried. DNA was resuspended in 0.5 ml sterile water. The 5'-3' oligomer sequences used for PCR were as follows: primer 1, AGCGCTTGTGTCGCCATTGTATTA; primer 2, GTCACACCACAGAAGTAAGGTTCC. The PCR reaction parameters were as follows: 30 cycles, 95°C for 1 min, 58°C for 2 min, and 70°C for 3 min yielding a product size of 1 kb.

CT cell isolation and culture. Ten mice (3-4 wk old) carrying a single copy of the H-2K^b-tsA58 transgene were killed, and the kidneys were removed, sliced and digested with collagenase type IV (0.5% wt/vol) in Hanks' balanced salt solution for 30 min at 37°C. The digest was centrifuged (800 g, 5 min), and the cell pellet was resuspended in cold culture medium with 10% FBS, centrifuged again, and resuspended in 5 mM glucose in PBS. The cell suspension was plated onto tissue culture dishes (Falcon 1058; Falcon-Becton Dickinson, Lincoln Park, NJ) coated with Dolichos biflorus agglutinin (DBA; 4°C, 10 µg/ml in 0.1 M NaHCO₃). DBA has been shown to specifically label the collecting duct (principal and intercalated cells) of the mouse kidney (26). Cells were allowed to adhere for 45 min at 4°C. Unbound cells were removed by washing three times with PBS-glucose at 4°C. Lectin-adhered cells were eluted by incubating in 10 ml of 150 mM galactose in PBS for 5 min. Cells were washed in glucose-PBS, centrifuged (800 g for 5 min), washed in culture medium, centrifuged (800 g, 5 min), and resuspended and plated in culture media at a density of 2 × 10⁵ cells/ml. Cells were maintained as primary cultures at 37°C for 7 days in defined basal CT media for CT epithelial cells that contained the following: 1:1 mix of DMEM and Ham's F-12 medium supplemented with 1.3 µg/l sodium selenite, 1.3 µg/l 3,3',5-triiodo-L-thyronine, 5 mg/l insulin, 5 mg/l transferrin, 25 µg/l PGE₁, 2.5 mM glutamine, and 5 µM dexamethasone (4, 40). Once colonies were established, recombinant mouse IFN- (10 U/ml) was added to the basal CT media, and cultures were expanded at the 33°C permissive temperature. mCT1 cells were maintained on plastic tissue culture dishes in CT media in a humidified 33°C incubator with 5% CO₂. Media was changed every other day, and cells were passaged weekly. Cells used for experiments reported here were between passages 10 and 25.

Morphology. Monolayers of mCT1 cells were seeded on collagen-coated Millicell-CM filters (12 mm; Millipore, Bedford, MA) and cultured in CT medium with IFN- at 33°C. Cell monolayers were fixed and embedded, and thin sections (80 nm) were cut normal to the filter. Sections were stained with uranyl acetate and lead citrate and examined with a JEOL 100 CX transmission electron microscope.

Conditional cell growth experiments. Cells were seeded at 5 × 10⁴ cells per well in 12-well plates and maintained at 33°C with IFN- (permissive conditions). Once cell number doubled, some plates were moved to 39°C without IFN- (nonpermissive conditions). At 24-h intervals thereafter, cells from triplicate wells were detached and cells were counted using a hemocytometer.

Immunofluorescent imaging microscopy. Subconfluent mCT1 cultures were grown on chamber slides in basal media with IFN- at 33°C or without IFN- at 39°C. Cells were fixed in an acidified ethanol solution (95% ethanol, 5% glacial acetic acid) for 1-2 min, rinsed three times with PBS, and blocked with 1% BSA for 1 h at room temperature. The cells were rinsed three times with PBS and incubated with a monoclonal mouse antibody to SV40 large T-antigen (0.2 µg/ml Ab-1; Oncogene Science, Uniondale, NY) in PBS containing 1% BSA for 2 h at room temperature. The PBS rinse was repeated prior to incubation with the fluorescent secondary antibody (Cy3-labeled goat anti-mouse IgG, 10 µg/ml; Jackson Laboratories, West Grove, PA) in PBS containing 1% BSA. After repeated rinsing in PBS, slides were coated with antifade solution (90% glycerol and 0.4% propyl gallate in H₂O). The mCT1 cells were examined using a Zeiss Axiovert model 35 inverted microscope equipped for epifluorescence, and digital images were acquired by a cooled charge-coupled device camera (model CH250; Photometrics, Tucson, AZ). Images were processed with Oncor Imaging image analysis program (Oncor Imaging, Rockville, MD) and recorded on an optical disc storage system.

mCT1 cells were seeded onto glass chamber slides (Nunc no. 177399) to identify DBA- (26), F₁₃- (14, 32, 39), and aquaporin-2-positive (33) cells. The cells were maintained under permissive conditions for 7 days, washed with PBS, and fixed for 10 min in methanol (20°C), then air dried and fixed for 10 min with paraformaldehyde (4%). The slides were washed and incubated overnight at 4°C with the appropriate primary antibody (F₁₃ or aquaporin-2) or DBA lectin. The slides were brought to room temperature, washed, and incubated for 90 min with the appropriate FITC- or Cy3-labeled secondary antibody. Samples examined for expression of aquaporin-2 were processed without the methanol permeabilization step. Samples were examined by epifluorescence microscopy, and representative fields were photographed.

Western blot analysis. Cell lysates were prepared from confluent culture dishes (60 mm) in lysis buffer containing 50 mM Tris · HCl (pH 7.5) and 1% SDS. Protein concentrations were measured by Pierce bicinchoninic acid protein assay (BCA; Pierce, Rockford, IL). Whole cell protein samples (25 µg) were denatured in SDS-PAGE sample buffer containing 50 mM Tris · HCl (pH, 6.8), 2% SDS, 5% -mercaptoethanol, 10% glycerol, and 0.1% bromphenol blue. Proteins were separated on a 7.5% SDS-PAGE gel and electrophoretically blotted onto a Immobilon-P polyvinylidene difluoride transfer membrane (PVDF, Millipore). Membranes were blocked overnight at 4°C in PBS that contained 5% dried milk (wt/vol) and 0.1% polyoxyethylenesorbitan monolaurate (Tween 20). The membranes were incubated at room temperature for 1 h with mouse monoclonal antibody, SV40 T Ag (Ab-1,1:500 dilution; Calbiochem, Cambridge, MA), in PBS/Tween. The membranes were then incubated with secondary antibody (horseradish peroxidase-conjugated sheep anti-mouse IgG, 1:2,000 dilution; Jackson Laboratories). Membranes were rinsed using three changes of washing buffer (PBS/Tween), once for 15 min and twice for 5 min after blocking and after each antibody incubation. Peroxidase-labeled membranes were developed by enhanced chemiluminescence (Amersham, Arlington Heights, IL). Protein bands were visualized on X-ray film (X-O-Mat; Kodak, Rochester, NY). Molecular mass estimation of detected bands was determined using prestained high-molecular mass protein standards (GIBCO, Life Technologies). Quantitation of the intensity of the bands on the luminograms was done using a Sci Scan 5000 densitometer. The OS-Scan Image Analyses System density scan program (Oberlin Scientific) was used to integrate the relevant peak areas in the protein bands.

Transepithelial electrical measurements. mCT1 cells were seeded (~200,000 cells/filter) on collagen-coated, permeable supports (Millicell-CM 12 filters, Millipore) cut to a height of 4 mm, with the feet removed (12). The filter surface was coated with 125 µl/cm² calf skin collagen (Sigma) dissolved in acetic acid (7.5 mg/ml of 0.2% glacial acetic acid) and allowed to dry. The collagen coating was cross-linked to the filter surface by exposure to ammonium hydroxide vapors (3.5% solution) for 10 min followed by immersion in glutaraldehyde (2.5%) for 10 min. This procedure was followed by a thorough rinsing in distilled water, 70% ethanol, distilled water, and finally, culture media. Filter-grown cells were cultured in basal CT medium with IFN- at 33°C. Media was changed every 48 h. Confluent filters were switched to nonpermissive conditions for some experiments. In all experiments, mCT1 monolayers were fed fresh media 18-24 h prior to analysis. Cell monolayers grown on modified supports were clamped between Lucite flux chambers and bathed on both sides by equal volumes (usually 6-10 ml) of Krebs-Ringer-bicarbonate solution (containing, in mM, 115 NaCl, 25 NaHCO₃, 5 KCl, 2.5 Na₂HPO₄, 1.8 CaCl₂, 1 MgSO₄, and 10 glucose). The solutions were circulated through the water-jacketed glass reservoir by gas lifts (95% O₂-5% CO₂), to maintain solution temperature at 37°C and pH. Transepithelial voltage difference (V_T) was measured between two Ringer-agar bridges, each positioned within 3 mm of the monolayer surface. Calomel half-cells connected the bridges to a high-impedance voltmeter. Current from an external direct current source was passed by silver-silver chloride electrodes and Ringer agar bridges to clamp the spontaneous V_T to zero. The current required (short-circuit current, I_sc) was corrected for solution and filter series resistance. Monolayers were maintained under short-circuit conditions except for brief 3- to 5-s intervals when the current necessary to clamp the voltage to a nonzero value (usually +2 mV) was measured to calculate R_T. Transepithelial electrical measurements were generally made on monolayers that had been in culture for between 7-21 days.

cAMP analysis. Cells were seeded at a density of 100,000 cells per filter and maintained under permissive conditions. On day 6, the cultures were washed and preincubated in HEPES-buffered Ringer solution at 37°C for 30 min. Epithelial monolayers were exposed on the luminal and basolateral sides to either IBMX (100 µM), IBMX plus AVP (10¹²-10⁸ M), or IBMX plus forskolin (FSK, 10 µM) for 10 min. Incubations were terminated by removal of bathing solution and addition of HCl to the luminal compartment (0.5 ml, 0.1 N) for 30 min to extract cAMP. The HCl was removed, neutralized, and stored at 70°C until analyzed for cAMP content. Cellular protein was solubilized by overnight incubation in NaOH (0.5 ml, 0.1 N). Protein content was measured by Pierce BCA protein assay. Free cAMP levels were assayed by competitive enzyme immunoassay (EIA; Cayman Chemical, Ann Arbor, MI) of acetylated samples.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

Cell morphology and immunocharacterization. CT cells displaced from the DBA-coated plates formed small islands of epithelial cells within 1 wk of growth in defined medium without IFN- at 37°C. The cultures were switched to permissive conditions (10 U IFN-/ml at 33°C), and the cells became confluent within 1 mo. Cultures were passaged several times and frozen in liquid nitrogen for future studies. The cells have now been maintained in culture for >50 passages. mCT1 cultures grown on permeable supports at the permissive temperature (Fig. 1) form a monolayer of cuboidal epithelial cells with junctional complexes, lateral-interdigitation, desmosomes, and microvilli on the apical membrane surface. DBA is known to bind exclusively to CT cells in the mouse kidney (26) and was used to isolate the mCT1 cell line. As expected, >95% of the mCT1 cells are positive for DBA lectin binding, suggesting that nearly all of the cells are derived from the CT (Fig. 2A). A monoclonal antibody (F₁₃/0121) that is specific for the principal cell of the mouse CT (14, 32, 39) labeled ~50% of the mCT1 cells (Fig. 2B). The remaining cells that are positive for DBA binding but negative for F₁₃ antibody binding may be dedifferentiated principal cells that have lost F₁₃ antigen expression; alternatively, they may be derived from the intercalated cells of the CT. The mCT1 cells were also evaluated for expression of aquaporin-2, the cAMP-regulated water channel present in the principal cells of the CT (33). Approximately one-half of the cells are positive for aquaporin-2 (Fig. 3). As mentioned above, the DBA-positive, aquaporin-2-negative cells may be dedifferentiated principal cells or may represent another CT epithelial cell type. As illustrated in Fig. 4, the presence of aquaporin-2 was confirmed by Western blot analysis of cells maintained under permissive conditions.

View larger version (147K): [in this window] [in a new window]   Fig. 1.   Transmission electron micrograph of cells from a conditionally immortalized collecting tubule cell line, mCT1. Cells were seeded onto collagen-coated porous supports and maintained under permissive conditions for 7 days. Cells form a continuous monolayer and exhibit apical microvilli and a junctional complex located at the apical aspect of two adjacent cells. Magnification, ×28,700.

View larger version (122K): [in this window] [in a new window]   Fig. 2.   Dolichos biflorus agglutinin (DBA) and F13 antibody binding to mCT1 cells. Cells were seeded onto glass slides and maintained under permissive conditions [33°C with interferon- (IFN-)] for 7 days. Cells were washed, fixed, and then labeled with either DBA (A and C) or F13 (B and D). FITC-labeled secondary antibodies were used to identify DBA-positive (C) or F13-positive (D) cells. Samples were examined by phase-contrast (A and B) or epifluorescence (C and D) microscopy and photographed. Magnification, ×110.

View larger version (152K): [in this window] [in a new window]   Fig. 3.   Immunofluorescent localization of aquaporin-2. MCT1 cells were seeded onto glass slides and maintained under permissive conditions (33°C with IFN-) for 7 days. Cells were washed, fixed, and then labeled either without (A and C) or with (B and D) antibody against aquaporin-2. Cy3-labeled secondary antibodies were used for detection. Samples were examined by phase-contrast (A and B) or epifluorescence (C and D) microscopy, and images were collected. Magnification, ×175.

View larger version (53K): [in this window] [in a new window]   Fig. 4.   Western blot analysis of aquaporin-2 expression in mCT1 cells. Lysates for Western blot analysis were prepared from confluent mCT1 cells grown under permissive conditions and from murine renal medulla (as a positive control). Samples were homogenized in RIPA buffer, and cellular debris was removed by centrifugation. Protein samples from mouse renal medulla (lane A; 20 µg protein) and mCT1 cells (lane B; 25 µg protein) were separated by SDS-PAGE electrophoretically transferred. Blots were probed with the aquaporin-2 primary antibody and peroxidase-coupled secondary antibody. Similar bands (~28 and ~34 kDa) were detected by ECL in both fresh renal medulla and mCT1 cells.

Immunolocalization of large T antigen protein demonstrated nuclear expression in essentially all cells. Figure 5 illustrates the expression of the large T antigen (monoclonal antibody PAb419) in mCT1 cells maintained under permissive (Fig. 5C) and nonpermissive conditions (Fig. 5D). In all fields observed, nearly 100% of the cells grown in permissive conditions express SV40 large T antigen in their nuclei. After 4 days under nonpermissive conditions, a dramatic decrease in the intensity of the nuclear label is clearly evident, illustrating the instability of the thermolabile large T antigen protein.

View larger version (175K): [in this window] [in a new window]   Fig. 5.   Immunofluorescent localization of large T antigen. mCT1 cells were seeded onto coverslips and grown under permissive conditions (33°C with IFN-) (A and C) or nonpermissive conditions (39°C without IFN-) for 4 days (B and D). Cells were incubated with a monoclonal antibody to SV40 large T antigen and labeled with Cy3-conjugated anti-mouse IgG. Phase-contrast (A and B) and fluorescence (C and D) images were collected. Magnification, ×180.

Bioelectric properties of monolayers maintained under permissive conditions. mCT1 cells (300,000 cells/cm²) were seeded onto collagen-coated permeable supports and maintained under permissive conditions. The cells attached and formed monolayers that were confluent 2 days later. When the epithelial monolayers were placed in an Ussing chamber, they generated a lumen-negative V_T and exhibited an I_sc value indicative of net ion transport (anion secretion, cation absorption, or both). The I_sc and R_T values for a series of monolayers (passages 13-23) maintained under permissive conditions for 3-12 days were measured. As illustrated in Fig. 6, I_sc increased between days 3 and 5 and remained steady thereafter, whereas R_T continued to increase between days 3 and 12. The mean values for I_sc and R_T measured on day 6 were 13.5 ± 2.0 µA/cm² and 836 ± 240  · cm² (n = 12), respectively. All subsequent bioelectric measurements were made on monolayers maintained in culture for 5-12 days.

View larger version (15K): [in this window] [in a new window]   Fig. 6.   Short-circuit current (Isc) and transepithelial resistance (RT) as a function of time after seeding. Cells were seeded onto permeable supports (300,000/cm2) and maintained under permissive conditions. On the appropriate day, filter was placed in an Ussing chamber and bathed on both sides by Krebs-Ringer-bicarbonate (KRB) solution. Isc and RT were measured 30 min later. Data are normalized to the values of Isc and RT measured on day 6 (Isc = 13.5 ± 2.0 µA/cm2, and RT = 836 ± 240  · cm2; n = 12). Each data point represents the mean ± SE of 3-12 filters from at least 3 different passages (passages 13-23).

Since the renal CT is known to express amiloride-sensitive, electrogenic Na⁺ absorption, we determined whether mCT1 monolayers grown under permissive conditions retain this property. An example of an I_sc trace recorded from a mCT1 monolayer is illustrated in Fig. 7. Addition of amiloride (epithelial sodium channel blocker) to the luminal bathing solution caused a rapid inhibition of I_sc. As summarized in Table 1, ~75-85% of the basal I_sc was inhibited and R_T was increased significantly by addition of amiloride (10 µM) to the luminal bathing solution. Subsequent exposure to FSK (10 µM, to increase intracellular cAMP) elicited a sustained increase in I_sc with no significant change in R_T (Fig. 7; Table 1).

View larger version (19K): [in this window] [in a new window]   Fig. 7.   Bioelectric properties of cultures maintained under permissive conditions. A confluent monolayer of mCT1 cells was maintained under permissive conditions for 8 days. Monolayer was mounted in an Ussing chamber and bathed on both sides with KRB solution maintained at 37°C. Transepithelial voltage difference (VT) was clamped to zero, and the resulting Isc was measured. At 1-min intervals, Vms was clamped to +2 mV to calculated RT. Basal Isc was recorded, and then amiloride (Amil; 10 µM) was added to the luminal bathing solution. Five minutes later, forskolin (For; 10 µM) was added to the basolateral bathing solution.

Effects of VP on mCT1 cells. Expression of tissue-specific receptors is often used as a measure of cellular differentiation in primary and immortalized cells. VP receptors located on the basolateral plasma membrane of CT cells are coupled to adenylate cyclase (2). Activation of the receptor leads to accumulation of intracellular cAMP and increases ion and water transport across the CT. Since VP-induced cAMP accumulation is a characteristic of CT cells, we sought to determine whether the mCT1 cells express functional receptors. We investigated the effects of AVP on cAMP accumulation and electrogenic ion transport by mCT1 cells maintained under permissive conditions. The dose-response relationships for VP-induced accumulation of cAMP and VP-mediated activation of I_sc of mCT1 cells grown on permeable supports are illustrated in Fig. 8. Significant increases in cAMP accumulation and I_sc were observed with as little as 10 pM VP.

View larger version (17K): [in this window] [in a new window]   Fig. 8.   Dose-response relationships for vasopressin (VP)-induced accumulation of cAMP and stimulation of Isc. mCT1 cells were seeded onto permeable supports and maintained under permissive conditions for 7 days. For measurements of Isc, monolayers were placed in Ussing chambers and bathed on both sides by KRB (solid bars). Amiloride (10 µM) was added to the luminal bathing solution to inhibit Na+ absorption, and increasing concentrations of VP (1012-108 M) were added to basolateral bathing solution at 5-min intervals thereafter. Values are means ± SE for 8 filters in each group. VP-stimulated cAMP accumulation in monolayers exposed to IBMX (100 µM) plus the indicated concentration of VP (1012-108 M) was determined (open bars). Amount of cell-associated cAMP generated during a 10-min incubation at 37°C was measured. Values are means ± SE for 3 filters in each group. * Value of Isc or cAMP accumulation is significantly different from the value in absence of VP (P < 0.05; ANOVA for repeat measures).

The effect of VP on I_sc was determined in monolayers pretreated with amiloride to inhibit sodium absorption; thus the electrogenic response to VP likely represents cAMP-mediated activation of Cl secretion. To test this, the effects of a Cl channel blocker [N-phenylanthranilic acid (DPC)] and bilateral Cl removal were examined. As illustrated in Fig. 9 and summarized in Table 2, replacement of bathing solution Cl with cyclamate prevented the VP-stimulated increase in I_sc. Furthermore, DPC (1 mM) added to the luminal bathing solution, inhibited the VP-stimulated I_sc in Cl-replete bathing solution, but did not affect I_sc of cultures bathed in Cl-free solution. These results, in conjunction with the activation of an amiloride-insensitive I_sc by FSK, suggest that elevation of cAMP in mCT1 cells activates electrogenic Cl secretion.

View larger version (13K): [in this window] [in a new window]   Fig. 9.   Effects of Cl replacement and N-phenylanthranilic acid (DPC) on VP-stimulated Isc. Confluent mCT1 monolayers, maintained under permissive conditions, were placed in an Ussing chamber and bathed on both sides by either KRB (A) or "zero-Cl KRB" (B) solution. Transepithelial voltage difference (VT) was clamped to zero, and the resulting Isc was measured. At 1-min intervals, VT was clamped to +2 mV to calculate RT. Amiloride (Amil; 10 µM) was added to the luminal bathing solution to inhibit Na+ absorption. Five minutes later, VP (108 M) was added to the basolateral bathing solution. Finally, DPC (1 mM) was added to the luminal bathing solution.

Effects of nonpermissive growth conditions on mCT1 cells. The transgenic ImmortoMouse does not develop tumors and exhibits only modest thymic hyperplasia, suggesting that the steady-state levels of the thermolabile large T antigen are sufficiently low in vivo to prevent excessive cellular proliferation. Because the mCT1 cell line that we generated appears to be immortal (>50 passages) when maintained under permissive conditions, we examined the effect of nonpermissive growth conditions on cell proliferation and steady-state large T antigen levels. The effects of either permissive or nonpermissive culture conditions on cell proliferation are illustrated by the growth curves shown in Fig. 10. Cells maintained under permissive conditions enter the log-phase of growth, whereas cells switched to nonpermissive conditions continue to proliferate slowly. After ~4 days in nonpermissive conditions, cell number remains constant. Cell proliferation resumes when mCT1 cultures are returned from nonpermissive conditions (2 days) to permissive conditions (data not shown). The amount of cell-associated large T antigen was assessed by Western blot analysis to determine the time course for the decline in large T antigen following a shift to nonpermissive conditions. A representative Western blot is shown in the top of Fig. 11. The results obtained from three separate experiments are summarized in the bottom of Fig. 11. The data are normalized to the amount of large T antigen present under permissive conditions (day 0). Large T antigen levels progressively decrease during the 4 days after cultures are switched to nonpermissive conditions. A significant decrease in band intensity is observed at each time point. Values for cells grown in nonpermissive conditions are 23 ± 4%, 15 ± 5.0%, 11 ± 2.0%, and 4 ± 2%, for days 1, 2, 3, and 4, respectively.

View larger version (17K): [in this window] [in a new window]   Fig. 10.   Effect of culture conditions on mCT1 cell proliferation. mCT1 cells were seeded at a density of 2 × 104 cells/well in 12-well tissue culture plates and maintained under permissive conditions (33°C with IFN-). Some cultures were switched to nonpermissive conditions (39°C without IFN-) on day 0. Cell numbers were determined for triplicate wells daily. Values are mean ± SE for 4 independent experiments.

View larger version (36K): [in this window] [in a new window]   Fig. 11.   Western blot analysis of large T antigen expression in mCT1 cells. Top: representative Western blot of large T antigen (94 kDa, arrowhead) from whole cell lysates of mCT1 cells grown under permissive conditions (day 0, far left lane) or maintained under nonpermissive conditions for 1, 2, 3, and 4 days. Bottom: time course for reduction in large T antigen in cells harvested at 0, 1, 2, 3 and 4 days following a switch from permissive (33°C with IFN-) to nonpermissive conditions (39°C without IFN-). Values obtained by quantitative densitometry were normalized to control cells grown at 33°C with IFN- (day 0). Data are means and SE of 3 separate experiments. * P < 0.001 (paired t-test).

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

The purpose of this work was to generate a conditionally immortalized CT cell line in which the influence of the immortalizing factor, large T antigen, can be modulated by culture conditions. We established a renal epithelial cell line from the ImmortoMouse (22), and the results of morphological and functional studies support the conclusion that mCT1 cells are conditionally immortalized and express CT characteristics.

A direct correlation exists between the level of large T antigen protein and the conditional growth that we observe in culture. mCT1 cells express a high level of immunoreactive nuclear large T antigen at the 33°C permissive temperature with IFN-, which is dramatically decreased after 4 days at the nonpermissive 39°C temperature without IFN-. Quantitative evaluation of large T antigen level demonstrated that after 4 days in nonpermissive conditions, the steady-state amount of large T antigen fell by more than 95%. We conclude that the high level of expression of large T antigen in mCT1 cells is consistent with the rapid proliferation observed in permissive conditions. Uncontrolled cell proliferation is a characteristic of poorly differentiated cells and is a feature of many SV40 large T antigen immortalized cell lines (18, 23, 29) and of mCT1 cultures grown under permissive conditions. The regulation of large T antigen expression is conditional in mCT1 cells and can be controlled by a switch to nonpermissive growth conditions. Concurrent with the fall in steady-state large T antigen level is a slowing of cell proliferation.

Microscopic investigation of the cell morphology of the mCT1 cell line shows clear evidence of cells with epithelial junctional complexes, lateral interdigitation, and apical microvilli, which are all hallmarks of a polarized epithelium. The cobblestone appearance and well-defined boundaries between adjacent cells of confluent monolayers also confirm an epithelial morphology. In addition, mCT1 cells stain positive for epithelial cytokeratins (data not shown). The mCT1 cell line retains electrophysiological properties typical of epithelium, in particular, CT epithelium (2, 5, 8, 16, 20, 24, 38, 39). Polarization and tight junction formation result in a high R_T and asymmetric electrogenic ion transport. In this regard, mCT1 cells have an advantage compared with several rabbit renal cell lines generated by in vitro transfection with either wild-type or temperature-sensitive SV40 large T antigen (1, 35, 42). Those cells do not form tight junctions, thus precluding the evaluation of transepithelial ion transport properties. mCT1 cells bind a CT-specific lectin (DBA), and a subset of the cell line expresses the F₁₃ antigen and aquaporin-2 water channel protein, suggesting that they are principal cells. The monolayers also express ion transport properties characteristic of principal cells of the CT. Specifically, the presence of electrogenic, amiloride-sensitive Na⁺ absorption and functional AVP receptors (AVP-induced cAMP production and stimulation of ion transport) suggest a well-differentiated CT epithelium. Since the AVP-stimulated increase in I_sc was Cl dependent and fully inhibited by DPC, it likely represents cAMP-activated Cl secretion. Several recent studies have provided compelling evidence for expression and cAMP-mediated activation of cystic fibrosis transmembrane conductance regulator (CFTR) in CT cells and cell lines (19, 21, 25, 27, 31, 40, 43). Thus our findings obtained from mCT1 cells maintained under permissive conditions are in accord with similar results from studies of primary cell cultures (19, 40) and unconditionally immortalized CT cell lines (25, 27, 39, 40) derived from wild-type SV40 transgenic mice.

Segment-specific hormone stimulation of adenylyl cyclase is frequently used as a marker to define the origin of primary cultures of renal epithelial cells and is generally associated with cellular differentiation (2, 9). AVP-stimulated cAMP accumulation and activation of electrogenic Cl secretion by mCT1 cells further supports a CT origin and suggests that the cells are at least moderately differentiated even under permissive growth conditions.

The mammalian renal tubule is predominantly an absorptive epithelium; however, in some species of fish, net fluid secretion driven by cAMP-stimulated NaCl secretion has been reported (6). Thus the secretory response observed in immortalized CT cells may represent the unmasking of a primitive transport pathway. Alternatively, as Kizer et al. (24) have suggested, Cl secretion by inner medullary collecting duct cells is physiologically relevant. Polycystic kidney diseases compose a group of renal disorders characterized by fluid-filled cysts lined by epithelial cells (3, 15). Cyst formation and enlargement are thought to require increased cellular proliferation and net secretion of salt and water. Accelerated proliferation results in a dedifferentiated cellular phenotype of the cells that line renal cysts. Grantham and coworkers (17, 28) demonstrated ion and fluid secretion in several in vitro models and suggested that enhanced cAMP-dependent Cl secretion may be responsible fluid accumulation by renal cysts. A subsequent study (19) which reported that CFTR channels are present in cells isolated from human renal cysts further supports a role for Cl secretion in cyst enlargement. Thus mCT1 cells maintained under permissive and nonpermissive conditions may serve as a useful model system for studies of the relationship between differentiation and ion transport by the renal epithelium.

In conclusion, we developed a conditionally immortalized cell line that forms epithelial monolayers and expresses properties of the CT and in which large T antigen levels and cell proliferation can be modulated by culture conditions.