|
|
||||||||
1 Institute of Physiology and 2 Institute of Anatomy, University of Zürich, CH-8057 Zürich; 3 Division de Néphrologie, Hôpital Cantonal Universitaire, CH-1211 Geneva; 4 Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot, Israel; 5 Institut de Pharmacologie et de Toxicologie, Université de Lausanne, CH-1005 Lausanne, Switzerland; 6 Department of Molecular and Cell Biology and The Cancer Research Laboratory, University of Califonia, Berkeley 94720; and 7 Division of Nephrology, Department of Medicine and Cellular and Molecular Pharmacology, University of California San Francisco, San Francisco, California 94143
| |
ABSTRACT |
|---|
|
|
|---|
Aldosterone controls sodium reabsorption and potassium
secretion in the aldosterone-sensitive distal nephron (ASDN). Although clearance measurements have shown that aldosterone induces these transports within 30-60 min, no early effects have been
demonstrated in vivo at the level of the apical epithelial sodium
channel (ENaC), the main effector of this regulation. Here we show by
real-time RT-PCR and immunofluorescence that an aldosterone injection
in adrenalectomized rats induces
-ENaC subunit expression along the
entire ASDN within 2 h, whereas
- and
-ENaC are
constitutively expressed. In the proximal ASDN portions only, ENaC is
shifted toward the apical cellular pole and the apical plasma membrane within 2 and 4 h, respectively. To address the question of whether the early aldosterone-induced serum and glucocorticoid-regulated kinase
(SGK) might mediate this apical shift of ENaC, we analyzed SGK
induction in vivo. Two hours after aldosterone, SGK was highly induced
in all segment-specific cells of the ASDN, and its level decreased
thereafter. In Xenopus laevis oocytes, SGK
induced ENaC activation and surface expression by a kinase
activity-dependent mechanism. In conclusion, the rapid in vivo
accumulation of SGK and
-ENaC after aldosterone injection takes
place along the entire ASDN, whereas the translocation of
,
,
-ENaC to the apical plasma membrane is restricted to its
proximal portions. Results from oocyte experiments suggest the
hypothesis that a localized activation of SGK may play a role in the
mediation of ENaC translocation.
Xenopus laevis oocytes; sodium transport; kidney; collecting duct; epithelial sodium channel; serum and glucocorticoid-regulated kinase
| |
INTRODUCTION |
|---|
|
|
|---|
ALDOSTERONE STIMULATES
Na+ reabsorption across its target epithelia, which are
located in the distal part of excretory organs, such as kidney, colon,
and salivary and sweat glands. The aldosterone target cells of the
kidney are the segment-specific cells, which in the case of the
collecting duct are also called principal cells, that form the
epithelium of the aldosterone-sensitive distal nephron (ASDN)
together with intercalated cells (which have no segment-specific characteristics). The ASDN includes the second half of the distal convoluted tubule (DCT2), the connecting tubule (CNT), the cortical collecting duct (CCD), and the medullary collecting duct (MCD). Na+ is reabsorbed across segment-specific cells of the ASDN
by a two-step process consisting of apical influx via the
epithelial Na+ channel (ENaC) and basolateral extrusion by
the Na+ pump (Na-K-ATPase) (8, 17, 25,
40-42). These cells are also characterized by a high
abundance of mineralocorticoid receptor and 11
-hydroxysteroid
dehydrogenase type 2 (3, 11).
The action of aldosterone has been shown to depend on transcription and translation. On the basis of studies made in model epithelia, its effect has been operationally divided into three major phases: a lag period of 20-60 min, followed by an early phase of Na+ transport increase mediated by aldosterone-induced regulatory proteins acting on the preexisting transport machinery (39), and a late/very late phase starting ~3 h after hormone addition, during which a further increase in transport activity correlates with an increase in channels, pumps, and other elements of the transport machinery (34, 42). Early effects of aldosterone, as early as in in vitro models, have been observed in vivo on renal Na+ and K+ excretion in adrenalectomized (Adx) animals and on the activity/number of Na-K-ATPase in isolated CCDs (4, 9, 16, 19).
No early aldosterone effects have been documented in vivo at the level of ENaC as yet, although Na+ influx through this channel represents the major limiting step in Na+ reabsorption (17). Functionally, the number of active ENaCs was shown to be extremely low in the apical plasma membrane of isolated CCDs from animals on a standard laboratory diet. This number was drastically increased by a long-term, low-salt diet, which also induced an increase in circulating aldosterone (31). A similar treatment was recently shown to induce a shift of the three ENaC subunits from an intracellular localization toward the apical surface of segment-specific cells of the distal nephron (25, 27).
As yet, two gene products, K-Ras2 and serum and glucocorticoid-regulated kinase (SGK), which are potential mediators of the early stimulatory action of aldosterone on ENaC function in vivo, have been isolated (6, 17, 28, 30, 36 ). Both are rapidly regulated by aldosterone and have been shown to activate coexpressed ENaC in the Xenopus laevis oocyte expression system and, in the case of K-Ras2, in A6 cell epithelia (6, 28, 30, 38). The effect of SGK on ENaC-mediated Na+ transport in X. laevis oocytes was recently shown to depend on an intact SGK kinase site (21) and to be caused by an increase in channel surface expression (1).
SGK is a serine/threonine kinase known to be expressed in several tissues (43, 45). Its physiological target(s) likely includes ENaC; other targets are not yet known. The activity of SGK has been shown to depend on its own phosphorylation, for instance, by PDK1, a phosphatidylinositol-3-phosphate-dependent kinase (20, 32).
SGK was shown to be induced very rapidly and strongly at the mRNA and protein levels by dexamethasone or aldosterone in A6 epithelia (6). In the kidney of Adx rats, in situ hybridizations indicated that SGK mRNA is induced within 4 h by aldosterone in structures that probably correspond to the collecting system (6). This in vivo induction has been corroborated by in vitro studies on rabbit CCD primary cell cultures showing a rapid SGK mRNA induction by both mineralocorticoid receptor- and glucocorticoid receptor-specific agonists (30).
In the present study we perfomed in vivo (rat kidney) and in vitro
(X. laevis oocytes) studies to localize
-ENaC and SGK induction by aldosterone in kidney tubules and address the question of
how their induction might relate to ENaC surface expression.
| |
METHODS |
|---|
|
|
|---|
Animals for tubule dissection and kidney morphology. Adult male Adx Wistar rats, with a body weight of 180-200 g, were purchased from Iffa Credo (l'Arbresle, France) and kept on a normal diet and water supplemented with 9 g/l NaCl. Aldosterone was injected subcutaneously (50 µg/100 g) 1 wk after adrenalectomy. The animals were anesthetized with thiopental (10 mg/100 g body wt ip) or pentobarbital sodium (5 mg/100 g body wt ip).
Preparation of rat tubule RNA.
Single proximal convoluted tubules (PT) and CCDs (1-2 mm each)
were isolated by microdissection as described previously
(12) and frozen in groups of two or three at
80°C.
Yeast tRNA (10 µg; Fluka, Buchs, Switzerland) was added to the
tubules with 500 µl TRIzol Reagent (GIBCO-BRL), and RNA was extracted
according to the manufacturer's protocol. RNA was resuspended in
H2O at a concentration of 0.1 µg/µl and 1/100 of the
input RNA (corresponding to 9-24 cells) was reverse transcribed
for each real-time PCR reaction.
Real-time RT-PCR.
RNA was first reverse transcribed with MultiScribe reverse
transcriptase (PE Applied Biosystems, Foster City, CA) according to the
manufacturer's instructions by using 2.5 µM random hexamers (with
tissue RNA) or oligo (dT)16 (with tubule RNA) for priming and a total RNA concentration of 10 ng/µl. Fluorescence changes during real- time quantitative PCR were measured with an ABI Prism 7700 sequence detector (PE Biosystems). All reactions were performed by
using the TaqMan PCR kit according the manufacturer's
recommendation (PE Biosystems). The PCR primers used were the
following: 5'-GCCAGGATAGAGCCACCAATC (actin);
3'-ACTGCCCTGGCTCCTAGCA (actin); 5'-GAGGGAGCGCTGCTTCCT (SGK); 3'-ACCCAAGGCACTGGCTATTTC (SGK); 5'-CAGGGTGATGGTGCATGGT (
-ENaC); 3'-CCACGCCAGGCCTCAAG (
-ENaC);
5'-CATAATCCTAGCCTGTCTGTTTGGA (
-ENaC);
3'-CAGTTGCCATAATCAGGGTAGAAGA (
-ENaC); 5'-TGCAAGCAATCCTGTAGCTTTAAG (
-ENaC); and 3'-GAAGCCTCAGACGGCCATT (
-ENaC). The fluorescent oligonucleotide probes that hybridize to the template between the PCR
primers were covalently labeled at their 5' ends with the reporter dye
6-carboxyfluorescin (FAM) and at their 3' ends via a linker arm with
the quencher 6-carboxytetramethylrhodamine (TAMRA; PE Biosystems).
These probes were for actin (CCATGAAGATCAAGATCATTGCTCCTCCT); SGK
(CCCCGTGCTCGCTTCTACGCA);
-ENaC (TGAAGCCACCATCATCCATAAAGGCAG);
-ENaC (CCCTGCAGTCATCGGAACTTCACACCT); and
-ENaC
(AATGGACACTGACCACCAGCTTGGC). Standard curves were generated by
using rat colon total RNA as template. The detection limit for actin,
SGK,
-ENaC, and
-ENaC was <80 pg of the RNA. The ratio of the
different signals to that of actin was calculated for every sample. The
results obtained for the different test conditions are given normalized
to the control values (fractional change in mRNA × expression,
relative to actin). The validity of the method was verified by
comparing the results obtained by real-time RT-PCR with those obtained
by Northern blotting on the same tissue RNA samples (r = 0.904, data not shown).
Immunohistochemistry on kidney sections.
Two and four hours after injection of vehicle (2 Adx rats/time point)
or aldosterone (3 Adx rats/time point), kidneys were fixed by vascular
perfusion and processed for immunohistochemistry as previously
described (23). Serial cryosections (4-8 µm) were incubated overnight at 4°C with either a polyclonal,
affinity-purified anti-SGK antiserum (dilution 1:500) or polyclonal
rabbit antisera against
-ENaC (dilution 1:1,000),
-ENaC (dilution
1:1,000), or
-ENaC (dilution 1:20,000). In some experiments,
sections were coincubated with a mouse monoclonal antibody (Ab) against
the vacuolar H+-ATPase (dilution 1:4). All antibodies have
been characterized previously (5, 8, 18). The binding
sites of the primary antibodies were revealed with a Cy3-conjugated
donkey anti-rabbit IgG (Jackson Immuno Research Labs, West Grove, PA)
diluted 1:1,000 and a FITC-conjugated goat anti-mouse IgG (Jackson
Immuno Research Laboratories) diluted 1:40, respectively. Subsequently,
the sections were processed according to routine procedures. Digitized
images were acquired with a Visicam charge-coupled device camera
(Visitron, Puchheim, Germany) and processed by Image-Pro Plus v3.0
software (Media Cybernetics, Silver Spring, MD). In control
experiments, the primary antibodies were omitted or replaced by a
non-immune rabbit serum. All control experiments yielded no
immunofluorescent staining.
Criteria for cortical distal segment identification on kidney sections. The initial segments of the ASDN, DCT2, and CNT are situated in the cortical labyrinth. The "landmark" for the CNT is its close vicinity to the cortical radial vessels. The CCDs are identified in the medullary rays.
Expression in oocytes and two-electrode, voltage-clamp
measurements.
X. laevis ENaC cDNAs in pSDeasy with a FLAG epitope sequence
(
- and
-ENaCF for binding and immunofluorescence) or
without (electrophysiology) were used (13, 28, 33). The
vector pSDeasy/SGK has been described (6). The K130A
mutation (with an alanine replacing lysine in the putative ATP binding
pocket) was introduced by PCR together with a silent AflII
restriction site (CTTAAG replacing CTCAAA) located 18 nucleotides
downstream of the lysine-alanine mutation (nucleotide sequence GCA
replacing AAA). Amplicons containing the mutations were digested with
AflII and flanking enzymes (BamHI for the
upstream and XbaI for the downstream fragment) and ligated into pSDeasy. PCR-amplified sequences were verified by DNA sequencing and SGK protein expression by Western blot (not shown). cDNA encoding the human ribosomal protein L28 was used as control (14).
After plasmids were linearized with BglII
(
-XENaC, XSGK), AflIII (
- and
-XENaC), or XhoI (L28), capped cRNA was
synthetized by using SP6 or T3 (L28) RNA polymerase, as previously
described (28). XENaC subunits (0.05 ng each wt
cRNA for electrophysiology or 5 ng cRNA with FLAG sequence for binding
and immunofluorescence) were coinjected either alone or together with 5 ng cRNA (10 ng for binding and immunofluorescence) of SGK, SGK-K130A,
or L28. Incubation of the oocytes and two-electrode voltage clamp were as previously described (28).
Iodination of M2Ab and binding assay. The iodination and binding procedures were as previously shown (28) and corresponded essentially to those described by Firsov et al. (13). The specific activity of the labeled M2 anti-FLAG monoclonal Ab (Kodak, Rochester, NY) ranged between 0.3 and 0.7 × 1018 cpm/mol, where cpm is counts/min. Background binding measured on H2O-injected oocytes amounted to 33% of the total binding on oocytes injected with ENaC cRNAs alone and was subtracted.
Immunohistochemical detection of ENaC in X. laevis oocytes. Fixation (24 h after injection with cRNA), embedding, and cryosectioning were as described previously (28). A tyramide signal amplification (TSA-Direct) kit (NEN, Boston, MA) was used for immunofluorescence according to the manufacturer's instructions, and XENaCF was detected with the M2 anti-FLAG IgG Ab as described (28). No staining was observed in experiments where the primary Ab was omitted. Sections were studied by epifluorescence.
Statistics. Data are expressed as means ± SE. The difference between control and test values was evaluated by using Student's t-test (2 tailed, unpaired, or 1 sample).
| |
RESULTS |
|---|
|
|
|---|
Rapid induction of
-ENaC by aldosterone in ASDN.
To quantitate the effect of aldosterone on tubular ENaC subunit mRNAs,
PTs and CCDs were microdissected from Adx rats and Adx rats that had
received a single subcutaneous injection of aldosterone (50 µg/100 g)
2 h before. As shown in Fig. 1, the mRNA of
-ENaC was induced in CCDs by a factor of 1.92 ± 0.25 (n = 12, from 4 rats/condition), whereas those for
-
and
-ENaC subunits were not significantly altered. ENaC mRNA was not
detected in PTs.
|
-ENaC was
undetectable in CCDs, whereas
- and
-ENaC were readily visible in
the cytoplasm of the segment-specific CCD cells. Two and four hours
after aldosterone injection, the presence of
-ENaC was indisputable
in the cytoplasm of CCD cells, indicating that aldosterone rapidly
increased its abundance. The amount of immunohistochemically revealed
-ENaC and the subcellular localization of ENaC subunits in the CCD
cells were not affected by the single aldosterone injection. The
-ENaC signal slightly decreased after 4 h. Changes similar to
those in CCD occurred in MCD (see Fig. 5B).
|
Aldosterone shifts ENaC toward the apical plasma membrane in
initial portions of the ASDN.
Immunohistochemistry disclosed that, in the initial portions of the
ASDN, aldosterone not only increased the abundance of
-ENaC but also
profoundly affected the subcellular localization of all three ENaC
subunits (Fig. 3). In Adx rats without
aldosterone administration,
- and
-subunits of ENaC were found in
a fine granular staining pattern exclusively throughout the cytoplasm of all segment-specific cells, and
-ENaC was undetectable (Fig. 3).
Two hours after aldosterone injection,
-ENaC was visible in the
cytoplasm of the segment-specific cells of the CNT. At that time point,
the intracellular staining for all three ENaC subunits was more
condensed in the upper third of most CNT cells. At 4 h, ENaC
subunits were shifted from the diffuse intracellular localization
toward the apical plasma membrane. The aldosterone-induced translocation of ENaC was most obvious for
-ENaC and was seen predominantly in the initial ASDN (DCT2 and the early CNT). Apical labeling decreased progressively along the CNT and was absent in the
CCD (Fig. 2).
|
SGK is rapidly induced by aldosterone in the ASDN.
Our previous in situ hybridization data suggested that, in Adx rats,
aldosterone induces SGK selectively in the distal nephron (6). Now, we quantified the induction of SGK mRNA in
microdissected PTs and CCDs from Adx rats by using real-time RT-PCR.
Two hours after aldosterone administration, SGK was increased by a
factor of 3.6 ± 0.5 in CCDs, whereas it remained unchanged in PTs
(Fig. 4). These results confirm that SGK
mRNA is rapidly induced by aldosterone on the mRNA level in rat CCDs.
|
-ENaC
antibodies, respectively. In untreated Adx animals, SGK was not
detectable in ENaC-positive tubular profiles of kidney cortex (Fig.
5A) and medulla (Fig. 5B). In contrast, 2 h
after aldosterone injection, SGK was highly abundant in all ENaC-expressing, segment-specific cells of the ASDN. Four hours after
aldosterone injection, SGK protein was still visible in the ASDN, but
the staining intensity had already declined. Along the entire ASDN,
induced SGK was homogenously distributed throughout the cytoplasm and
always extranuclearly, compatible with a cytosolic localization. SGK
was not seen in intercalated cells that were identified by their strong
binding to H-ATPase antibodies (Fig. 6).
|
|
SGK increases ENaC activity in X. laevis oocytes by a mechanism
involving its kinase activity.
We and others have previously shown that SGK expression in X. laevis oocytes increases the transport activity of
coexpressed ENaC (6, 30). We have now tested
whether the kinase activity of X. laevis SGK might be
required to mediate this effect by selectively mutating a single amino
acid (K130A) known to be required for the function of its consensus
kinase site (32). Although expression of wild-type SGK
increased the amiloride-sensitive current fourfold, expression of the
kinase-dead mutant SGK decreased it (Fig.
7A). The lack of ENaC activity
upregulation by the kinase-dead SGK indicates that its kinase activity
is required for this action. The twofold lower current observed in the
presence of kinase-dead SGK further suggests a competition of
this overexpressed mutant protein with an endogenous one (dominant
negative effect). The fact that coexpression of an unrelated protein
(ribosomal protein L28) did not interfere with the ENaC-mediated sodium
current (data not shown) excludes the possibility that the effect of
kinase-dead SGK was due to competition at the translational level.
|
SGK acts on ENaC activity by increasing its surface expression in
X. laevis oocytes.
To test whether the functional change induced by SGK coexpression might
be explained by changes in XENaC surface expression, we
measured the binding of monoclonal antibodies (M2Ab) to
epitope tags introduced in the extracellular loop of the
- and
-ENaC subunits (Fig. 7B) (13, 28). The
results of this binding experiment correlate with the functional
results shown in Fig. 7A. Coexpressed SGK increased the
surface binding by a factor of 3.26 ± 0.72, and kinase-dead SGK
decreased it by a factor of 0.76 ± 0.12.
| |
DISCUSSION |
|---|
|
|
|---|
Aldosterone induces
-ENaC accumulation and
,
,
-ENaC
surface expression in ASDN.
Previous in vivo studies have shown that chronic elevations of
plamsa aldosterone levels induce in kidney
aldosterone-target epithelia an increase in
-ENaC subunit expression
at the mRNA and protein levels. In contrast,
- and
-ENaC appear
to be expressed constitutively in ASDN (2, 7, 10, 22, 26,
27). The present study shows that, in kidney of Adx rats,
accumulation of
-ENaC protein is recognizable as early as 2 h
after a single aldosterone injection and remains at approximately the
same level during the following 2 h. This upregulation of
-ENaC
occurs in all segment-specific cells of the ASDN. The about twofold
rise in the level of
-ENaC mRNA (2 h after aldosterone injection) appears small compared with the striking increase in immunofluorescence from zero in Adx rats to bright immunostaining in Adx+aldosterone rats.
This suggests that, in the mammalian distal nephron, the regulation of
-ENaC protein abundance might also involve posttranscriptional mechanisms in addition to
-ENaC transcription. A previous in vitro
study on A6 epithelia suggested this possibility (29).
Is SGK a mediator of ENaC surface expression? A recently published study (1) as well as the present study show that coexpression of SGK with ENaC increases the number of active channels at the cell surface in the X. laevis oocyte expression system. To investigate whether SGK, as a mediator of aldosterone, might promote ENaC surface expression in vivo, we visualized the localization of its expression in kidney. Aldosterone injection induced an important SGK accumulation within 2 h in all ENaC-positive segments, the level of which was already reduced after 4 h. This shows that SGK has a short half-life and suggests that it might be regulated as rapidly in mammals in vivo as previously shown in amphibian A6 cell epithelia (6). The onset of SGK accumulation apparently precedes the visible apical translocation of ENaC and also likely precedes or coincides with the physiological response observed at the level of the Na+ and K+ clearance (i.e., between 30 and 60 min after the beginning of an aldosterone treatment) (9, 19). However, the fact that the aldosterone-induced accumulation of SGK is localized to the entire ASDN stands in contrast to the limitation of ENaC translocation to a proximal part of the ASDN. The present study shows that the kinase catalytic site of SGK needs to be intact for promoting ENaC surface expression in X. laevis oocytes. This complements the notion that SGK needs to be phosphorylated to be an active kinase and that 3-phosphoinositide-dependent protein kinase 1 (PDK1) functions as an upstream kinase of SGK (32). Furthermore, recent experiments showed that inhibition of phosphoinositol 3-kinase (PI3-kinase) activity markedly reduces SGK stimulation of ENaC activity in the oocyte system. PI3-kinase inhibition also prevented both phophorylation of SGK and mineralocorticoid-induced Na+ transport in A6 cells (44). Together with these results, our study shows that SGK expression per se is not sufficient to promote ENaC surface expression in X. laevis oocytes as well as in epithelial cells. In the oocyte system, this effect of SGK is shown to depend on its own catalytic activity, and thus, phosphorylation.
Role of SGK and
-ENaC induction in ENaC surface expression: a
hypothesis.
Together, the present in vivo and in vitro data suggest the following
hypothesis for the regulation of ENaC cell surface expression by
aldosterone in ASDN: SGK is rapidly induced by aldosterone and, if
activated, promotes the translocation of available
,
,
-ENaC toward the surface. Activation of SGK requires its phosphorylation by a
PDK1(-like) kinase. This phosphorylation could be controlled by an
axially heterogenous mechanism that thereby restricts ENaC translocation to more or less long upstream portions of the ASDN. In
the absence of aldosterone, the availability of preassembled ENaC is
limited by a low level of
-ENaC. Hence, by inducing an upregulation
of
ENaC, aldosterone also leads to a progressive increase in the
pool of assembled
,
,
-ENaC available for translocation to the surface.
-ENaC
along the entire ENaC-expressing ASDN. We hypothesize that SGK might
play an important role in the translocation of ENaC to the apical cell
surface by integrating the transcriptional aldosterone action with
signals that might be differentially available along the ASDN.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Ian Forster for assistance with the electrophysiological experiments, Christian Gasser for artwork, Lea Kläusli for technical assistance, Steven Gluck (St. Louis, MO) for providing the monoclonal anti-vacuolar H+-ATPase antibody, and Annette Audigé (Bern, Switzerland) for providing unpublished primer and probe sequences for real-time PCR measurements of the rat ENaC subunits. The laboratory of F. Verrey was supported by Swiss NSF Grants 31-49727.96 and 31-59141.99, that of B. Kaissling by Swiss NSF Grant 31-47742.96.
| |
FOOTNOTES |
|---|
* J. Loffing and M. Zecevic contributed equally to this work.
Address for reprint requests and other correspondence: F. Verrey, Institute of Physiology, Univ. of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland (E-mail: verrey{at}physiol.unizh.ch).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 25 August 2000; accepted in final form 7 November 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alvarez de la Rosa, D,
Zhang P,
Naray-Fejes-Toth A,
Fejes-Toth G,
and
Canessa CM.
The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes.
J Biol Chem
274:
37834-37839,
1999
2.
Asher, C,
Wald H,
Rossier BC,
and
Garty H.
Aldosterone-induced increase in the abundance of Na+ channel subunits.
Am J Physiol Cell Physiol
271:
C605-C611,
1996
3.
Bachmann, S,
Bostanjoglo M,
Schmitt R,
and
Ellison DH.
Sodium transport-related proteins in the mammalian distal nephron
distribution, ontogeny and functional aspects.
Anat Embryol
200:
447-468,
1999[Medline].
4.
Barlet-Bas, C,
Khadoury C,
Marsy S,
and
Doucet A.
Sodium-independent in vitro induction of Na+,K+-ATPase by aldosterone in renal target cells: permissive effect of triiodothyronine.
Proc Natl Acad Sci USA
85:
1707-1711,
1988
5.
Buse, P,
Tran SH,
Luther E,
Phu PT,
Aponte GW,
and
Firestone GL.
Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, SGK, in mammary tumor cells
a novel convergence point of anti-proliferative and proliferative cell signaling pathways.
J Biol Chem
274:
7253-7263,
1999
6.
Chen, S,
Bhargava A,
Mastroberardino L,
Meijer OC,
Wang J,
Buse P,
Firestone GL,
Verrey F,
and
Pearce D.
Epithelial sodium channel regulated by aldosterone-induced protein sgk.
Proc Natl Acad Sci USA
96:
2514-2519,
1999
7.
Dijkink, L,
Hartog A,
Deen PMT,
van Os CH,
and
Bindels RJM
Time-dependent regulation by aldosterone of the amiloride-sensitive Na+ channel in rabbit kidney.
Pflügers Arch
438:
354-360,
1999[Web of Science][Medline].
8.
Duc, C,
Farman N,
Canessa CM,
Bonvalet JP,
and
Rossier BC.
Cell-specific expression of epithelial sodium channel alpha, beta, and gamma subunits in aldosterone-responsive epithelia from the rat: localization by in situ hybridization and immunocytochemistry.
J Cell Biol
127:
1907-1921,
1994
9.
El Mernissi, G,
and
Doucet A.
Short-term effect of aldosterone on renal sodium transport and tubular Na-K-ATPase in the rat.
Pflügers Arch
339:
139-146,
1983.
10.
Escoubet, B,
Coureau C,
Bonvalet JP,
and
Farman N.
Noncoordinate regulation of epithelial Na channel and Na pump subunit mRNAs in kidney and colon by aldosterone.
Am J Physiol Cell Physiol
272:
C1482-C1491,
1997
11.
Farman, N.
Steroid receptors: distribution along the nephron.
Semin Nephrol
12:
12-17,
1992[Web of Science][Medline].
12.
Feraille, E,
Carranza ML,
Buffin-Meyer B,
Rousselot M,
Doucet A,
and
Favre H.
Protein kinase C-dependent stimulation of Na+-K+-ATPase in rat proximal convoluted tubules.
Am J Physiol Cell Physiol
268:
C1277-C1283,
1995
13.
Firsov, D,
Schild L,
Gautschi I,
Merillat AM,
Schneeberger E,
and
Rossier BC.
Cell surface expression of the epithelial Na channel and a mutant causing Liddle syndrome
a quantitative approach.
Proc Natl Acad Sci USA
93:
15370-15375,
1996
14.
Frigerio, JM,
Dagorn JC,
and
Iovanna JL.
Cloning, sequencing and expression of the L5, L21, L27a, L28, S5, S9, S10 and S29 human ribosomal protein mRNAs.
Biochim Biophys Acta
1262:
64-68,
1995[Medline].
15.
Frindt, G,
Silver RB,
Windhager EE,
and
Palmer LG.
Feedback regulation of Na channels in rat CCT. III. Response to cAMP.
Am J Physiol Renal Fluid Electrolyte Physiol
268:
F480-F489,
1995
16.
Fujii, Y,
Takemoto F,
and
Katz AI.
Early effects of aldosterone on Na-K pump in rat cortical collecting tubules.
Am J Physiol Renal Fluid Electrolyte Physiol
259:
F40-F45,
1990
17.
Garty, H,
and
Palmer LG.
Epithelial sodium channels
function, structure, and regulation.
Physiol Rev
77:
359-396,
1997
18.
Hemken, P,
Guo XL,
Wang ZQ,
Zhang K,
and
Gluck S.
Immunologic evidence that vacuolar H+ ATPases with heterogeneous forms of Mr = 31,000 subunit have different membrane distributions in mammalian kidney.
J Biol Chem
267:
9948-9957,
1992
19.
Horisberger, JD,
and
Diezi J.
Effects of mineralocorticoids on Na+ and K+ excretion in the adrenalectomized rat.
Am J Physiol Renal Fluid Electrolyte Physiol
245:
F89-F99,
1983
20.
Kobayashi, T,
and
Cohen P.
Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 PDK1 and PDK2.
Biochem J
339:
319-328,
1999.
21.
Lang, F,
Klingel K,
Wagner CA,
Stegen C,
Warntges S,
Friedrich B,
Lanzendorfer M,
Melzig J,
Moschen I,
Steuer S,
Waldegger S,
Sauter M,
Paulmichl M,
Gerke V,
Risler T,
Gamba G,
Capasso G,
Kandolf R,
Hebert SC,
Massry SG,
and
Broer S.
Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy.
Proc Natl Acad Sci USA
97:
8157-8162,
2000
22.
Lingueglia, E,
Renard S,
Waldmann R,
Voilley N,
Champigny G,
Plass H,
Lazdunski M,
and
Barbry P.
Different homologous subunits of the amiloride-sensitive Na+ channel are differently regulated by aldosterone.
J Biol Chem
269:
13736-13739,
1994
23.
Loffing, J,
Loffing-Cueni D,
Hegyi I,
Kaplan MR,
Hebert SC,
Le Hir M,
and
Kaissling B.
Thiazide treatment of rats provokes apoptosis in distal tubule cells.
Kidney Int
50:
1180-1190,
1996[Web of Science][Medline].
24.
Loffing, J,
Loffing-Cueni D,
Macher A,
Hebert SC,
Olson B,
Knepper MA,
Rossier BC,
and
Kaissling B.
Localization of epithelial sodium channel and aquaporin-2 in rabbit kidney cortex.
Am J Physiol Renal Physiol
278:
F530-F539,
2000
25.
Loffing, J,
Pietri L,
Aregger F,
Bloch-Faure M,
Meneton P,
Rossier BC,
and
Kaissling B.
Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets.
Am J Physiol Renal Physiol
279:
F252-F258,
2000
26.
MacDonald, P,
MacKenzie S,
Ramage LE,
Seckl JR,
and
Brown RW.
Corticosteroid regulation of amiloride-sensitive sodium-channel subunit mRNA expression in mouse kidney.
J Endocrinol
165:
25-37,
2000[Abstract].
27.
Masilamani, S,
Kim GH,
Mitchell C,
Wade JB,
and
Knepper MA.
Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney.
J Clin Invest
104:
R19-R23,
1999[Medline].
28.
Mastroberardino, L,
Spindler B,
Forster I,
Loffing J,
Assandri R,
May A,
and
Verrey F.
Ras pathway activates epithelial Na+ channel and decreases its surface expression in Xenopus oocytes.
Mol Biol Cell
9:
3417-3427,
1998
29.
May, A,
Puoti A,
Gaeggeler HP,
Horisberger JD,
and
Rossier BC.
Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells.
J Am Soc Nephrol
8:
1813-1822,
1997[Abstract].
30.
Naray-Fejes-Toth, A,
Canessa C,
Cleaveland ES,
Aldrich G,
and
Fejes-Toth G.
Sgk is an aldosterone-induced kinase in the renal collecting duct
effects on epithelial Na+ channels.
J Biol Chem
274:
16973-16978,
1999
31.
Pacha, J,
Frindt G,
Antonian L,
Silver RB,
and
Palmer LG.
Regulation of Na channels of the rat cortical collecting tubule by aldosterone.
J Gen Physiol
102:
25-42,
1993
32.
Park, J,
Leong ML,
Buse P,
Maiyar AC,
Firestone GL,
and
Hemmings BA.
Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway.
EMBO J
18:
3024-3033,
1999[Web of Science][Medline].
33.
Puoti, A,
May A,
Canessa CM,
Horisberger JD,
Schild L,
and
Rossier BC.
The highly selective low-conductance epithelial Na channel of Xenopus laevis A6 kidney cells.
Am J Physiol Cell Physiol
269:
C188-C197,
1995
34.
Rachamim, N,
Latter H,
Malinin N,
Asher C,
Wald H,
and
Garty H.
Dexamethasone enhances expression of mitochondrial oxidative phosphorylation genes in rat distal colon.
Am J Physiol Cell Physiol
269:
C1305-C1310,
1995
35.
Schafer, JA,
and
Hawk CT.
Regulation of Na+ channels in the cortical collecting duct by AVP and mineralocorticoids.
Kidney Int
41:
255-268,
1992[Web of Science][Medline].
36.
Spindler, B,
Mastroberardino L,
Custer M,
and
Verrey F.
Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia.
Pflügers Arch
434:
323-331,
1997[Web of Science][Medline].
37.
Staub, O,
Abriel H,
Plant P,
Ishikawa T,
Kanelis V,
Saleki R,
Horisberger JD,
Schild L,
and
Rotin D.
Regulation of the epithelial Na+ channel by Nedd4 and ubiquitination.
Kidney Int
57:
809-815,
2000[Web of Science][Medline].
38.
Stockand, JD,
Spier BJ,
Worrell RT,
Yue G,
Al-Baldawi N,
and
Eaton DC.
Regulation of Na+ reabsorption by the aldosterone-induced small G protein K-Ras2A.
J Biol Chem
274:
35449-35454,
1999
39.
Verrey, F.
Early aldosterone action: toward filling the gap between transcription and transport.
Am J Physiol Renal Physiol
277:
F319-F327,
1999
40.
Verrey, F.
Transcriptional control of sodium transport in tight epithelia by adrenal steroids.
J Membr Biol
144:
93-110,
1995[Web of Science][Medline].
41.
Verrey, F,
Beron J,
and
Spindler B.
Corticosteroid regulation of renal Na,K-ATPase.
Miner Electrolyte Metab
22:
279-292,
1996[Web of Science][Medline].
42.
Verrey, F,
Hummler E,
Schild L,
and
Rossier BC.
Control of Na+ transport by aldosterone.
In: The Kidney: Physiology and Pathophysiology (3rd ed.), edited by Seldin DW,
and Giebiesch G.. New York: Lippincott, Williams & Wilkins, 2000.
43.
Waldegger, S,
Barth P,
Raber G,
and
Lang F.
Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume.
Proc Natl Acad Sci USA
94:
4440-4445,
1997
44.
Wang, J,
Barbry P,
Maiyar AC,
Rozansky DJ,
Bhargava A,
Leong M,
Firestone GL,
and
Pearce D.
SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport.
Am J Physiol Renal Physiol
280:
F303-F313,
2001
45.
Webster, MK,
Goya L,
Ge Y,
Maiyar AC,
and
Firestone GL.
Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum.
Mol Cell Biol
13:
2031-2040,
1993
This article has been cited by other articles:
![]() |
P. Svenningsen, T. R. Uhrenholt, Y. Palarasah, K. Skjodt, B. L. Jensen, and O. Skott Prostasin-dependent activation of epithelial Na+ channels by low plasmin concentrations Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2009; 297(6): R1733 - R1741. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ziera, H. Irlbacher, A. Fromm, C. Latouche, S. M. Krug, M. Fromm, F. Jaisser, and S. A. Borden Cnksr3 is a direct mineralocorticoid receptor target gene and plays a key role in the regulation of the epithelial sodium channel FASEB J, November 1, 2009; 23(11): 3936 - 3946. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. B. Olesen, S. de Seigneux, G. Wang, S. C. Lutken, J. Frokiaer, T.-H. Kwon, and S. Nielsen Rapid and segmental specific dysregulation of AQP2, S256-pAQP2 and renal sodium transporters in rats with LPS-induced endotoxaemia Nephrol. Dial. Transplant., August 1, 2009; 24(8): 2338 - 2349. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Jesse, J. McCartney, X. Feng, E. M. Richards, C. E. Wood, and M. Keller-Wood Expression of ENaC subunits, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R453 - R461. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Ackermann, K. M. Boini, H. Volkl, M. Bhandaru, P. M. Bareiss, L. Just, V. Vallon, K. Amann, D. Kuhl, Y. Feng, et al. SGK1-sensitive renal tubular glucose reabsorption in diabetes Am J Physiol Renal Physiol, April 1, 2009; 296(4): F859 - F866. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Butterworth, R. S. Edinger, R. A. Frizzell, and J. P. Johnson Regulation of the epithelial sodium channel by membrane trafficking Am J Physiol Renal Physiol, January 1, 2009; 296(1): F10 - F24. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Hills, P. E Squires, and R. Bland Serum and glucocorticoid regulated kinase and disturbed renal sodium transport in diabetes J. Endocrinol., December 1, 2008; 199(3): 343 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Artunc, O. Nasir, K. Amann, K. M. Boini, H.-U. Haring, T. Risler, and F. Lang Serum- and glucocorticoid-inducible kinase 1 in doxorubicin-induced nephrotic syndrome Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1624 - F1634. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Raikwar, P. M. Snyder, and C. P. Thomas An evolutionarily conserved N-terminal Sgk1 variant with enhanced stability and improved function Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1440 - F1448. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Boulkroun, D. Ruffieux-Daidie, J.-J. Vitagliano, O. Poirot, R.-P. Charles, D. Lagnaz, D. Firsov, S. Kellenberger, and O. Staub Vasopressin-inducible ubiquitin-specific protease 10 increases ENaC cell surface expression by deubiquitylating and stabilizing sorting nexin 3 Am J Physiol Renal Physiol, October 1, 2008; 295(4): F889 - F900. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Estilo, W. Liu, N. Pastor-Soler, P. Mitchell, M. D. Carattino, T. R. Kleyman, and L. M. Satlin Effect of aldosterone on BK channel expression in mammalian cortical collecting duct Am J Physiol Renal Physiol, September 1, 2008; 295(3): F780 - F788. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Frindt, Z. Ergonul, and L. G. Palmer Surface Expression of Epithelial Na Channel Protein in Rat Kidney J. Gen. Physiol., June 1, 2008; 131(6): 617 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fejes-Toth, G. Frindt, A. Naray-Fejes-Toth, and L. G. Palmer Epithelial Na+ channel activation and processing in mice lacking SGK1 Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1298 - F1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Raikwar and C. P. Thomas Nedd4-2 isoforms ubiquitinate individual epithelial sodium channel subunits and reduce surface expression and function of the epithelial sodium channel Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1157 - F1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Taruno, N. Niisato, and Y. Marunaka Intracellular calcium plays a role as the second messenger of hypotonic stress in gene regulation of SGK1 and ENaC in renal epithelial A6 cells Am J Physiol Renal Physiol, January 1, 2008; 294(1): F177 - F186. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, C. S. Wingo, and S.-L. Xia Downregulation of SGK1 by nucleotides in renal tubular epithelial cells Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1751 - F1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Hughey and T. R. Kleyman Functional cross talk between ENaC and pendrin Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1439 - F1440. [Full Text] [PDF] |
||||
![]() |
J. A. Martel, D. Michael, G. Fejes-Toth, and A. Naray-Fejes-Toth Melanophilin, a novel aldosterone-induced gene in mouse cortical collecting duct cells Am J Physiol Renal Physiol, September 1, 2007; 293(3): F904 - F913. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, W. Wang, R. Norregaard, M. A. Knepper, S. Nielsen, and J. Frokiaer Altered expression of epithelial sodium channel in rats with bilateral or unilateral ureteral obstruction Am J Physiol Renal Physiol, July 1, 2007; 293(1): F333 - F341. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cordas, A. Naray-Fejes-Toth, and G. Fejes-Toth Subcellular location of serum- and glucocorticoid-induced kinase-1 in renal and mammary epithelial cells Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1971 - C1981. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fakitsas, G. Adam, D. Daidie, M. X. van Bemmelen, F. Fouladkou, A. Patrignani, U. Wagner, R. Warth, S. M.R. Camargo, O. Staub, et al. Early Aldosterone-Induced Gene Product Regulates the Epithelial Sodium Channel by Deubiquitylation J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1084 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-T. Chang, M.-S. Wu, Y.-C. Tian, K.-H. Chen, C.-C. Yu, C.-H. Liao, C.-C. Hung, and C.-W. Yang Enhancement of epithelial sodium channel expression in renal cortical collecting ducts cells by advanced glycation end products Nephrol. Dial. Transplant., March 1, 2007; 22(3): 722 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Fuster, I. A. Bobulescu, J. Zhang, J. Wade, and O. W. Moe Characterization of the regulation of renal Na+/H+ exchanger NHE3 by insulin Am J Physiol Renal Physiol, February 1, 2007; 292(2): F577 - F585. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Thiesson, B. L. Jensen, C. Bistrup, P. D. Ottosen, A. D. McNeilly, R. Andrew, J. Seckl, and O. Skott Renal sodium retention in cirrhotic rats depends on glucocorticoid-mediated activation of mineralocorticoid receptor due to decreased renal 11beta-HSD-2 activity Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R625 - R636. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, J. Frokiaer, M. A. Knepper, and S. Nielsen Maintained ENaC trafficking in aldosterone-infused rats during mineralocorticoid and glucocorticoid receptor blockade Am J Physiol Renal Physiol, January 1, 2007; 292(1): F382 - F394. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al. Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol Rev, October 1, 2006; 86(4): 1151 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ergonul, G. Frindt, and L. G. Palmer Regulation of maturation and processing of ENaC subunits in the rat kidney Am J Physiol Renal Physiol, September 1, 2006; 291(3): F683 - F693. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Boini, A. M. Hennige, D. Y. Huang, B. Friedrich, M. Palmada, C. Boehmer, F. Grahammer, F. Artunc, S. Ullrich, D. Avram, et al. Serum- and glucocorticoid-inducible kinase 1 mediates salt sensitivity of glucose tolerance. Diabetes, July 1, 2006; 55(7): 2059 - 2066. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, G. Henke, C. Sandu, R. Rexhepaj, A. Hussain, B. Friedrich, T. Risler, M. Metzger, L. Just, T. Skutella, et al. Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1 Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1114 - G1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, J. Frokiaer, M. A. Knepper, and S. Nielsen Lithium-induced NDI in rats is associated with loss of {alpha}-ENaC regulation by aldosterone in CCD Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1222 - F1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, F. Artunc, D. Sandulache, R. Rexhepaj, B. Friedrich, T. Risler, J. A. McCormick, K. Dawson, J. Wang, D. Pearce, et al. Renal function of gene-targeted mice lacking both SGK1 and SGK3 Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R945 - R950. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, K. M. Boini, B. Friedrich, M. Metzger, L. Just, H. Osswald, P. Wulff, D. Kuhl, V. Vallon, and F. Lang Blunted hypertensive effect of combined fructose and high-salt diet in gene-targeted mice lacking functional serum- and glucocorticoid-inducible kinase SGK1 Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R935 - R944. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, X. Xia, D. I. Jalal, T. Kuncewicz, W. Xu, G. D. Lesage, and B. C. Kone Aldosterone-sensitive repression of ENaC{alpha} transcription by a histone H3 lysine-79 methyltransferase Am J Physiol Cell Physiol, March 1, 2006; 290(3): C936 - C946. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Kim, S. de Seigneux, M. C. Sassen, J. Lee, J. Kim, M. A. Knepper, J. Frokiaer, and S. Nielsen Increased apical targeting of renal ENaC subunits and decreased expression of 11betaHSD2 in HgCl2-induced nephrotic syndrome in rats Am J Physiol Renal Physiol, March 1, 2006; 290(3): F674 - F687. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Helve, S. Andersson, T. Kirjavainen, and O. M. Pitkanen Improvement of Lung Compliance during Postnatal Adaptation Correlates with Airway Sodium Transport Am. J. Respir. Crit. Care Med., February 15, 2006; 173(4): 448 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, C. Li, L. N. Nejsum, H. Li, S. W. Kim, T.-H. Kwon, T. E. N. Jonassen, M. A. Knepper, K. Thomsen, J. Frokiaer, et al. Biphasic effects of ANP infusion in conscious, euvolumic rats: roles of AQP2 and ENaC trafficking Am J Physiol Renal Physiol, February 1, 2006; 290(2): F530 - F541. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shimizu, T. Yoshida, M. Wakamori, M. Ishii, T. Okada, M. Takahashi, M. Seto, K. Sakurada, Y. Kiuchi, and Y. Mori Ca2+-calmodulin-dependent myosin light chain kinase is essential for activation of TRPC5 channels expressed in HEK293 cells J. Physiol., January 15, 2006; 570(2): 219 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Makhanova, G. Lee, N. Takahashi, M. L. Sequeira Lopez, R. A. Gomez, H.-S. Kim, and O. Smithies Kidney function in mice lacking aldosterone Am J Physiol Renal Physiol, January 1, 2006; 290(1): F61 - F69. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lourdel, J. Loffing, G. Favre, M. Paulais, A. Nissant, P. Fakitsas, C. Creminon, E. Feraille, F. Verrey, J. Teulon, et al. Hyperaldosteronemia and Activation of the Epithelial Sodium Channel Are Not Required for Sodium Retention in Puromycin-Induced Nephrosis J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3642 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing and L. Schild Functional Domains of the Epithelial Sodium Channel J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3175 - 3181. [Full Text] [PDF] |
||||
![]() |
Z. Yu, A. Serra, D. Sauter, J. Loffing, D. Ackermann, F. J. Frey, B. M. Frey, and B. Vogt Sodium retention in rats with liver cirrhosis is associated with increased renal abundance of NaCl cotransporter (NCC) Nephrol. Dial. Transplant., September 1, 2005; 20(9): 1833 - 1841. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McCormick, V. Bhalla, A. C. Pao, and D. Pearce SGK1: A Rapid Aldosterone-Induced Regulator of Renal Sodium Reabsorption Physiology, April 1, 2005; 20(2): 134 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. E. Veizis and C. U. Cotton Abnormal EGF-dependent regulation of sodium absorption in ARPKD collecting duct cells Am J Physiol Renal Physiol, March 1, 2005; 288(3): F474 - F482. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Boyd and A. Naray-Fejes-Toth Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1 Am J Physiol Renal Physiol, March 1, 2005; 288(3): F505 - F512. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Keller-Wood, C. E. Wood, Y. Hua, and D. Zhang Mineralocorticoid Receptor Expression in Late-Gestation Ovine Fetal Lung Reproductive Sciences, February 1, 2005; 12(2): 84 - 91. [Abstract] [PDF] |
||||
![]() |
V. Vallon, P. Wulff, D. Y. Huang, J. Loffing, H. Volkl, D. Kuhl, and F. Lang Role of Sgk1 in salt and potassium homeostasis Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R4 - R10. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang Surfing the lipid bilayer: how basolateral insulin receptors regulate Na+ channels in the apical cell membrane. Focus on "Real-time three-dimensional imaging of lipid signal transduction: apical membrane insertion of epithelial Na+ channels" Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1539 - C1540. [Full Text] [PDF] |
||||
![]() |
G. Frindt and L. G. Palmer Apical potassium channels in the rat connecting tubule Am J Physiol Renal Physiol, November 1, 2004; 287(5): F1030 - F1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meneton, J. Loffing, and D. G. Warnock Sodium and potassium handling by the aldosterone-sensitive distal nephron: the pivotal role of the distal and connecting tubule Am J Physiol Renal Physiol, October 1, 2004; 287(4): F593 - F601. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1 Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing, V. Vallon, D. Loffing-Cueni, F. Aregger, K. Richter, L. Pietri, M. Bloch-Faure, J. G.J. Hoenderop, G. E. Shull, P. Meneton, et al. Altered Renal Distal Tubule Structure and Renal Na+ and Ca2+ Handling in a Mouse Model for Gitelman's Syndrome J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2276 - 2288. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fouladkou, R. Alikhani-Koopaei, B. Vogt, S. Y. Flores, L. Malbert-Colas, M.-C. Lecomte, J. Loffing, F. J. Frey, B. M. Frey, and O. Staub A naturally occurring human Nedd4-2 variant displays impaired ENaC regulation in Xenopus laevis oocytes Am J Physiol Renal Physiol, September 1, 2004; 287(3): F550 - F561. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Dave, N. Schulz, M. Zecevic, C. A. Wagner, and F. Verrey Expression of heteromeric amino acid transporters along the murine intestine J. Physiol., July 15, 2004; 558(2): 597 - 610. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Kim, W. Wang, J. Nielsen, J. Praetorius, T.-H. Kwon, M. A. Knepper, J. Frokiaer, and S. Nielsen Increased expression and apical targeting of renal ENaC subunits in puromycin aminonucleoside-induced nephrotic syndrome in rats Am J Physiol Renal Physiol, May 1, 2004; 286(5): F922 - F935. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Huang, P. Wulff, H. Volkl, J. Loffing, K. Richter, D. Kuhl, F. Lang, and V. Vallon Impaired Regulation of Renal K+ Elimination in the sgk1-Knockout Mouse J. Am. Soc. Nephrol., April 1, 2004; 15(4): 885 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Coric, N. Hernandez, D. A. de la Rosa, D. Shao, T. Wang, and C. M. Canessa Expression of ENaC and serum- and glucocorticoid-induced kinase 1 in the rat intestinal epithelium Am J Physiol Gastrointest Liver Physiol, April 1, 2004; 286(4): G663 - G670. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Frindt and L. G. Palmer Na channels in the rat connecting tubule Am J Physiol Renal Physiol, April 1, 2004; 286(4): F669 - F674. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Summa, S. M. R. Camargo, C. Bauch, M. Zecevic, and F. Verrey Isoform specificity of human Na+,K+-ATPase localization and aldosterone regulation in mouse kidney cells J. Physiol., March 1, 2004; 555(2): 355 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Rossier The Epithelial Sodium Channel: Activation by Membrane-Bound Serine Proteases Proceedings of the ATS, January 1, 2004; 1(1): 4 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, J. Praetorius, Y.-H. Kim, J. Frokiaer, M. A. Knepper, and S. Nielsen Segment-specific ENaC downregulation in kidney of rats with lithium-induced NDI Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1198 - F1209. [Abstract] [Full Text] |
||||
![]() |
O. A. Weisz and J. P. Johnson Noncoordinate regulation of ENaC: paradigm lost? Am J Physiol Renal Physiol, November 1, 2003; 285(5): F833 - F842. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gumz, M. P. Popp, C. S. Wingo, and B. D. Cain Early transcriptional effects of aldosterone in a mouse inner medullary collecting duct cell line Am J Physiol Renal Physiol, October 1, 2003; 285(4): F664 - F673. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. de la Rosa, T. Coric, N. Todorovic, D. Shao, T. Wang, and C. M Canessa Distribution and regulation of expression of serum- and glucocorticoid-induced kinase-1 in the rat kidney J. Physiol., September 1, 2003; 551(2): 455 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Auberson, N. Hoffmann-Pochon, A. Vandewalle, S. Kellenberger, and L. Schild Epithelial Na+ channel mutants causing Liddle's syndrome retain ability to respond to aldosterone and vasopressin Am J Physiol Renal Physiol, September 1, 2003; 285(3): F459 - F471. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lebowitz, B. An, R. S. Edinger, M. L. Zeidel, and J. P. Johnson Effect of altered Na+ entry on expression of apical and basolateral transport proteins in A6 epithelia Am J Physiol Renal Physiol, September 1, 2003; 285(3): F524 - F531. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G. Muller, R. G. Parnova, G. Centeno, B. C. Rossier, D. Firsov, and J.-D. Horisberger Mineralocorticoid Effects in the Kidney: Correlation between {alpha}ENaC, GILZ, and Sgk-1 mRNA Expression and Urinary Excretion of Na+ and K+ J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1107 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takada and M. Kasai Prolactin increases open-channel density of epithelial Na+ channel in adult frog skin J. Exp. Biol., April 15, 2003; 206(8): 1319 - 1323. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing and B. Kaissling Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human Am J Physiol Renal Physiol, April 1, 2003; 284(4): F628 - F643. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Alvarez de la Rosa and C. M. Canessa Role of SGK in hormonal regulation of epithelial sodium channel in A6 cells Am J Physiol Cell Physiol, February 1, 2003; 284(2): C404 - C414. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Na, Y. K. Oh, J. S. Han, K. W. Joo, J. S. Lee, J.-H. Earm, M. A. Knepper, and G.-H. Kim Upregulation of Na+ transporter abundances in response to chronic thiazide or loop diuretic treatment in rats Am J Physiol Renal Physiol, January 1, 2003; 284(1): F133 - F143. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Yun, M. Palmada, H. M. Embark, O. Fedorenko, Y. Feng, G. Henke, I. Setiawan, C. Boehmer, E. J. Weinman, S. Sandrasagra, et al. The Serum and Glucocorticoid-Inducible Kinase SGK1 and the Na+/H+ Exchange Regulating Factor NHERF2 Synergize to Stimulate the Renal Outer Medullary K+ Channel ROMK1 J. Am. Soc. Nephrol., December 1, 2002; 13(12): 2823 - 2830. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Conti Specificity of the Cyclic Adenosine 3',5'-Monophosphate Signal in Granulosa Cell Function Biol Reprod, December 1, 2002; 67(6): 1653 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nielsen, T.-H. Kwon, S. Masilamani, K. Beutler, H. Hager, S. Nielsen, and M. A. Knepper Sodium transporter abundance profiling in kidney: effect of spironolactone Am J Physiol Renal Physiol, November 1, 2002; 283(5): F923 - F933. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kamynina and O. Staub Concerted action of ENaC, Nedd4-2, and Sgk1 in transepithelial Na+ transport Am J Physiol Renal Physiol, September 1, 2002; 283(3): F377 - F387. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Busjahn, A. Aydin, R. Uhlmann, C. Krasko, S. Bahring, T. Szelestei, Y. Feng, S. Dahm, A. M. Sharma, F. C. Luft, et al. Serum- and Glucocorticoid-Regulated Kinase (SGK1) Gene and Blood Pressure Hypertension, September 1, 2002; 40(3): 256 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Schafer Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct Am J Physiol Renal Physiol, August 1, 2002; 283(2): F221 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Matthay, H. G. Folkesson, and C. Clerici Lung Epithelial Fluid Transport and the Resolution of Pulmonary Edema Physiol Rev, July 1, 2002; 82(3): 569 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kellenberger and L. Schild Epithelial Sodium Channel/Degenerin Family of Ion Channels: A Variety of Functions for a Shared Structure Physiol Rev, July 1, 2002; 82(3): 735 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Rozansky, J. Wang, N. Doan, T. Purdy, T. Faulk, A. Bhargava, K. Dawson, and D. Pearce Hypotonic induction of SGK1 and Na+ transport in A6 cells Am J Physiol Renal Physiol, July 1, 2002; 283(1): F105 - F113. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Biner, M.-P. Arpin-Bott, J. Loffing, X. Wang, M. Knepper, S. C. Hebert, and B. Kaissling Human Cortical Distal Nephron: Distribution of Electrolyte and Water Transport Pathways J. Am. Soc. Nephrol., April 1, 2002; 13(4): 836 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Stockand New ideas about aldosterone signaling in epithelia Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Ma, S. Saxena, and D. G. Warnock Anionic Phospholipids Regulate Native and Expressed Epithelial Sodium Channel (ENaC) J. Biol. Chem., March 1, 2002; 277(10): 7641 - 7644. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Wade Distribution of transporters along the mouse distal nephron: something old, something borrowed, something new Am J Physiol Renal Physiol, December 1, 2001; 281(6): F1019 - F1020. [Full Text] [PDF] |
||||
![]() |
D. Rotin, V. Kanelis, and L. Schild Trafficking and cell surface stability of ENaC Am J Physiol Renal Physiol, September 1, 2001; 281(3): F391 - F399. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Faletti, N. Perrotti, S. I. Taylor, and B. L. Blazer-Yost sgk: an essential convergence point for peptide and steroid hormone regulation of ENaC-mediated Na+ transport Am J Physiol Cell Physiol, March 1, 2002; 282(3): C494 - C500. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loffing, D. Loffing-Cueni, V. Valderrabano, L. Klausli, S. C. Hebert, B. C. Rossier, J. G. J. Hoenderop, R. J. M. Bindels, and B. Kaissling Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron Am J Physiol Renal Physiol, December 1, 2001; 281(6): F1021 - F1027. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |