AJP - Renal Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 283: F454-F463, 2002. First published March 19, 2002; doi:10.1152/ajprenal.00012.2002
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/F454    most recent
00012.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goldberg, M.
Right arrow Articles by Warburton, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goldberg, M.
Right arrow Articles by Warburton, D.
Vol. 283, Issue 3, F454-F463, September 2002

Identification and expression analysis of the human µ-protocadherin gene in fetal and adult kidneys

Michael Goldberg1, Michelle Wei2,3, Benjamin Tycko2,3, Inna Falikovich1, and Dorothy Warburton1

Departments of 1 Pediatrics and 2 Pathology and 3 Institute for Cancer Genetics, College of Physicians and Surgeons, Columbia University, New York, New York 10032


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We recently cloned µ-protocadherin, a developmentally regulated cell adhesion molecule that contains an extracellular region with four cadherin-like ectodomains and a triply repeating mucin domain in its longer isoform. Expression of µ-protocadherin in L929 cells resulted in cellular aggregation, confirming its role in intercellular adhesion. We now identify the human µ-protocadherin ortholog and study its distribution in vivo and its targeting in polarized epithelia. Basic Local Alignment Search Tool searches and fluorescent in situ hybridization analysis on the basis of human-mouse synteny reveal that µ-protocadherin maps to 11p15.5, matching a previously identified gene called MUCDHL. At least three different splicing isoforms exist for MUCDHL that vary in expression in the fetal kidney. µ-Protocadherin is apically expressed along the brush border of the proximal convoluted tubule of the adult kidney. Transfection of truncated forms of µ-protocadherin into polarized Madin-Darby canine kidney cells reveals that the NH2 terminus is essential for targeting to the apical surface. These results suggest that although human µ-protocadherin may mediate a homotypic adhesive interaction, it may have additional functions in terminally differentiated epithelia.

cell adhesion; apical targeting


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

DYNAMIC CHANGES IN CELL ADHESION are requisite for the generation of the three-dimensional structure of the kidney. Three consecutive branching patterns utilizing lateral and bifid branches occur during nephrogenesis (1). During the generation of a branch, cells must escape the restrictions imposed on them by cell adhesion molecules, the matrix, and the basement membrane and then proliferate. However, despite this requirement for plasticity, cells still need to maintain some adherence to one another. One class of cell adhesion molecules found to be critical for these processes are the cadherins, defined by their calcium-dependant homophilic cell adhesion properties. Their cytoplasmic region binds beta -catenin and is linked to the actin cytoskeleton through alpha -catenin and actinin (30).

Several mechanisms exist regulating these adhesive interactions during nephrogenesis (see Ref. 9 for review). These include the rapid assembly of adheren junctions, an increase in the clustering of the adhesive complexes and/or an increase in their affinity, or an alteration in the turnover of the cell junction (14). Finally, differential expression of the cadherins can drive nephrogenesis by stimulating aggregation of subsets of cells expressing the same type of cadherin (4). The greater affinity of respective cadherins to each other likely facilitates rearrangements within a cluster of cells. This type of molecular rearrangement is termed "sorting" and is one mechanism of generation of a polar structure, as has been demonstrated within rhombomeres of the central nervous system (28).

We recently identified a novel cell adhesion molecule from the kidney termed µ-protocadherin (GenBank accession no. AF221952) (8). Several aspects of µ-protocadherin highlight its potential importance in the regulation of such dynamic interactions. Its cDNA encodes a novel integral membrane protein, which contains four cadherin-like ectodomains in its extracellular region, and a triply repeating mucin domain in its longest isoform. The latter domain is known to negatively regulate cadherin function in carcinoma cells (15). Alternatively, the mucin may also provide specificity for its adhesive interactions by binding to its sugar moiety. This is analogous to the selectin-binding carbohydrate determinants of the mucin domains on mucosal addressin cell adhesion molecule-1 that support the rolling of lymphocytes under shear (3). A shorter isoform lacks the mucin domain and is independently regulated in the kidney during the perinatal period (8). Expression of the long isoform in L929 cells results in cell-to-cell aggregation, confirming its role in intercellular adhesion (8).

We sought to identify the human µ-protocadherin ortholog and examine its expression in the developing kidney. Members of the cadherin superfamily are numerous and diverse (24). One identifying criterion distinguishing µ-protocadherin is the presence of the mucin repeats tandem to the cadherin ectodomains. Basic Local Alignment Search Tool (BLAST) search of the National Center for Biotechnology Information human database detected just one gene, termed MUCDHL, with a comparable extracellular domain. MUCDHL was identified within a 500-kb contig spanning the region between c-HRAS and MUC2 on chromosome 11p15.5 (20). Identical structural motifs between MUCDHL and µ-protocadherin, spanning the full length of the protein, provide strong evidence that MUCDHL is the human ortholog of µ-protocadherin. Confirmation that MUCDHL was the µ-protocadherin ortholog was made on the basis of rodent-human comparison using fluorescence in situ hybridization (FISH) analysis. Hybridization with a µ-protocadherin-derived mouse bacterial artificial chromosome (BAC) clone localized this gene to distal chromosome 7 band F4 of the mouse, which is syntenic to human 11p15.5.

Pairwise alignment of the human µ-protocadherin ortholog and expressed sequences in GenBank identified at least three alternatively spliced forms of human µ-protocadherin. The first two forms differ in the presence of the mucin domain, whereas the third isoform, interestingly, has a shortened 13th exon and lacks the mucin and transmembrane domain. Differential expression of these messages was noted in the kidney and liver by Northern blot analysis. Immunocytochemistry in the adult kidney demonstrated apical expression along the brush border of the proximal convoluted tubule. Localization of this protein to the apical surface can be further demonstrated on transfection of MUCDHL into polarized Madin-Darby canine kidney (MDCK) cells. The NH2 terminus is essential for this apical targeting. These results suggest that the compartmentalization of human µ-protocadherin to the apical surface may facilitate additional functions of terminally differentiated epithelia.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Taq polymerase was obtained from Fisher Scientific (Suwanee, GA). Deoxynucleotide primers for PCRs were synthesized by Gene Link (Thornwood, NY). Tris base, glycerol, sodium chloride, and Triton X-100 were from Sigma (St. Louis, MO). Human multiple tissue Northern blots were obtained from Clontech (Palo Alto, CA). Transwell filters were purchased from Corning Costar (Cambridge MA). Paraformaldehyde was purchased from Electron Microscopy Sciences (Ft. Washington, PA). The GC-rich PCR system and Lipofectamine 2000 were purchased from Life Technologies (Rockville, MD)

Cell culture. MDCK cells were grown in DMEM/Ham's F-12 supplemented with FCS. Caco-2 cells were obtained from the American Type Culture Collection and grown in MEM with 2 mM L-glutamine, Earle's balanced salt solution adjusted to contain 1.5 g/l sodium bicarbonate, 0.1 mM nonessential amino acids, 1.0 mM sodium pyruvate, and 20% fetal bovine serum.

FISH analysis of mouse µ-protocadherin. A genomic BAC clone containing the µ-protocadherin gene was obtained by screening a mouse BAC library with the cytoplasmic region of mouse µ-protocadherin derived from GenBank accession no. W18538 (Research Genetics). It was further subcloned, and a 7.5-kb genomic fragment containing, in part, the 5'-regulatory region was obtained. This was used to hybridize to mouse metaphase chromosomes. Dual staining with FITC-labeled chromosome 7 paint confirmed the identity of the chromosome. Chromosomes were banded by the 4,6-diamidino-2-phenylindole counterstain.

Structural analysis of the human µ-protocadherin gene. BLAST analysis of the human database identified the human ortholog of µ-protocadherin (GenBank accession no. AF256874). The exon-intron structure was obtained by pairwise alignment of the human ortholog (AF256874) and mRNAs AF258676, AF276242, and AF258675 using the gap2 program with the GCG server.

Northern blot analysis of µ-protocadherin. Human fetal blot and multiple adult human tissue Northern blots were obtained from Clontech (Palo Alto, CA). The fetal kidney mRNA was derived from a pool of males and females aged 21-30 wk, fetal liver mRNA aged 18-24 wk, fetal lung aged 20-25 wk, and fetal brain aged 16-32 wk (Dr. Yonca Ilkbahar, Clontech Labs). It was hybridized with the cytoplasmic region of human µ-protocadherin (GenBank accession no. AI640262). The cytoplasmic insert was 32P labeled by a random primed reaction. A multiple blot containing mRNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (Clontech) was also hybridized, but no bands were detected and therefore the results were not illustrated.

Generation of antibodies. Rabbit polyclonal antibodies were generated against the cytoplasmic region of human µ-protocadherin. A sequence corresponding to amino acids 525-651 of NP_112554 was ligated into pGEX (Amersham Pharmacia, Piscataway, NJ) to create a glutathione S-transferase (GST)-fusion protein and transformed into BL21 Escherichia coli cells. The fusion protein was purified on an immobilized GST column (Pierce), and the amino acid sequence was verified by mass spectroscopy after trypsin digestion. Soluble fusion protein was injected into rabbits for generation of polyclonal antisera (Pocono Rabbit Farm & Laboratory, Canadensis, PA).

Immunoblot analysis. Adult and fetal kidney tissue (Columbia University Cancer Center Tissue Bank) was extracted with SDS-PAGE buffer containing beta -mercaptoethanol. A preliminary Coomassie-stained gel was performed to equalize the amount of protein that was loaded on each lane (data not shown). Rabbit antibody directed against a GST-fusion protein with the cytoplasmic domain of human µ-protocadherin was generated and used as the primary antibody. Preimmune serum was used as the negative control. No staining was seen with the preimmune serum (data not shown).

Generation and transient transfection of µ-protocadherin isoforms. A PCR using GC-rich enzyme and expressed sequence tag (EST) AK-000384 as a template with the primer pair aattaaaagcttcagaccctcctgccaggtgacagccg and aattaacacgtggatgtaggagtcatcaccaccgggcg generated the full-length cDNA of the short isoform of µ-protocadherin. 3'-adenosine overhangs were added with Taq polymerase, and then the PCR product was cloned into the 3'-T overhang of a pcDNA3.1/V5-His TOPO targeting vector (Invitrogen, Carlsbad, CA). In a second construct, a stop codon was placed at the 3'-terminus to ensure correct termination of translation and cloned into the pcDNA5/FRT/V5-His TOPO targeting vector. The cloning of the mucin containing full-length rat isoform was previously described (8). PCR reactions utilizing the primer pairs aattaaccgcggaacccttcttccaggtgacagctg and aaatagcggccgcttagtgaaccgatgtcggtagtg, and aatctttccgcggtcatatcaggagtaggcgagctg and aattaagcggccgcacgtaagtgttgtctgcgactg containing KspI and NotI sites at their ends were used to generate NH2-terminal (lacking intracellular domain) or COOH-terminal (lacking the extracellular domain) forms of rat µ-protocadherin, respectively. They were then cloned into the KspI and NotI sites of the pHM6 cloning vector, which contains a 3'-His tag (Boehringer Mannheim). MDCK cells were seeded the day before onto Transwell filters such that they were 85-90% confluent at the time of transfection. MDCK cells were transfected utilizing Lipofectamine 2000 and then cultured for an additional 48-72 h for transient expression analysis. Under these experimental conditions, MDCK cells form a polarized monolayer, which was confirmed by measurement of their electrical resistance. Filters were then processed for immunocytochemistry.

Immunocytochemistry. The staining protocol was performed as previously described (8), with some minor modifications. Paraformaldehyde-fixed tissue sections (4-5 µm thick) were blocked with 100% FCS in PBS before the addition of primary antibody. A high-titer rabbit polyclonal serum directed against µ-protocadherin was diluted at 1:100 and incubated with sections for 1 h at room temperature. A pool of anti-pancytokeratin mouse monoclonal antibodies, AE1, AE3 (Chemicon), and KL1 (Immunotech), were utilized to identify collecting tubules and visualized after incubation with a rhodamine-conjugated secondary antibody. Monoclonal antibody to neutral endopeptidase was purchased from Coulter Immunology (Hialeah, FL). Caco-2 cells, which endogenously express µ-protocadherin, were seeded close to confluency and analyzed after 4 days by confocal microscopy. Expression of the truncated forms of µ-protocadherin in MDCK transfected cells was detected using an anti-His monoclonal antibody. Propidium iodide staining (25 µg/ml) was utilized to detect nuclei. Stained monolayers were mounted onto a glass coverslip in fluorescent mounting medium (DAKO) and viewed with an Axiovert 100 laser scanning confocal microscope (model LSM 410, Carl Zeiss). Excitation with an argon-krypton laser in the 488-, 568-, and 645-nm channels was used to visualize fluorescein, rhodamine, or propidium iodide, and Cy5-conjugated secondary antibodies, respectively. Images were collected as 1-µm-thick optical sections, and orthogonal sections were generated using Zeiss LSM-PC software. Final images were processed using Adobe Photoshop.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

FISH. To facilitate the study of the µ-protocadherin-mediated pathway and its regulation, a mouse BAC clone containing the µ-protocadherin gene was obtained. This was used as a first step to identify the human ortholog of µ-protocadherin by FISH and mouse-human syntenic analysis. Metaphase spreads of mouse chromosomes were hybridized with a rhodamine-labeled µ-protocadherin-derived mouse BAC clone (Fig. 1). Signal was seen on both chromosome 7 orthologs on the most distal chromosome band F4. This was confirmed by two-color FISH using a rhodamine-labeled µ-protocadherin-derived mouse BAC clone and an FITC-labeled chromosome paint probe derived from chromosome 7. Because many and often diverse members constitute the protocadherin superfamily, mapping of the mouse ortholog provided an important clue to the localization of the human µ-protocadherin gene on the basis of human-mouse synteny. Of possible interest for future studies, the distal end of mouse chromosome 7 is syntenic to 11p15.5, an imprinted region that is often subject to a loss of heterozygosity in Wilms tumors (6).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Chromosome localization of mouse µ-protocadherin gene. Metaphase spread of mouse chromosomes hybridized with a rhodamine-labeled µ-protocadherin mouse bacterial artificial chromosome clone (red). Signal is seen on both chromosome 7 orthologs, which is confirmed by dual staining with FITC-labeled chromosome 7 paint (green). Chromosomes are banded by the 4,6-diamidino-2-phenylindole counterstain.

Comparison of the amino acid sequence of human and rat µ-protocadherin orthologs. BLAST search of the human database led initially to two ESTs with homology to rat µ-protocadherin. (GenBank accession nos. AK000384 and AK000226). These ESTs were subsequently shown to be derived from the MUCDHL gene (GenBank accession no. AF258674) (20). Overall, there was >60% identity, and >70% were positives between the rat and human proteins (data not shown). Regions of identity spanned the full length of the protein. Closer examination of the structural motifs present in the human protein provides strong evidence that it is the human ortholog of µ-protocadherin.

The consensus sequence for the µ-protocadherin cadherin ectodomains is shown in Fig. 2A. The amino acid alignment of the human and rat µ-protocadherin ectodomains is presented with rat FAT (16) and human protocadherin gamma -a2 for comparison (29). Blocked letters indicate identical amino acid sequences. Dark and light shading indicate more conserved and less conserved amino acid sequences, respectively. Ectodomains 1-4 are indicated by EC1-EC4, respectively. Numbering refers to the size of the cadherin repeat. Presented in Fig. 2B is a dendogram tree, indicating clustering of ectodomains by similarity. The similarity tree of rat and human µ-protocadherin ectodomains reveals that respective ectodomains are more similar to each other than to any other cadherin ectodomains obtained by the BLAST search. A comparison is made to its two most closely related ectodomains obtained by the BLAST search, the rat ortholog of the Drosophila melanogaster tumor suppressor FAT and the human protocadherin gamma -a2. These results suggest that rat µ-protocadherin and the MUCDHL gene are orthologous and may constitute a new subdivision within the cadherin superfamily (19).


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of human and rat µ-protocadherin orthologs. A: µ-protocadherin ectodomains were aligned with ectodomains from its human ortholog (expressed sequence tag AK000384) using Clustal W1.8. White letters on a black background indicate identical amino acid sequences. Dark and light shading indicate more-conserved to less-conserved amino acid sequences, respectively. Bottom: consensus sequence. Ectodomains 1-4 (EC1-EC4) are prefixed by species name. Numbers refer to size of the cadherin repeat. B: dendogram tree of rat and human µ-protocadherin ectodomains reveal that respective ectodomains are most similar to each other. The two most closely related ectodomains (on the basis of Basic Local Alignment Search Tool analysis), rat FAT, and human protocadherin gamma -a2, are presented for comparison. C: identical structure of the mucin repeat region (M1-M4) is noted between rat (AF221952) and human µ-protocadherin (AF258676). Each repeat consisting of 30-31 amino acids is lettered in alternating colors: transmembrane region, bold; SH3 binding regions, red; PDZ binding region, orange.

The identical structure of the mucin repeats region is noted between the rat (AF221952) and human µ-protocadherin ortholog (AF258676) (Fig. 2C). The mucin region is repeated 3.5 times and noted by M1-M4. The mucin domain was shown to be glycosylated in vivo in the rat kidney (8). On the basis of neural network predictions of mucin-type GalNAc O-glycosylation sites in mammalian proteins (23), the mucin region of the human µ-protocadherin gene is similarly predicted to be heavily glycosylated (data not shown). Conservation of the size and number of repeats within the mucin domain between the rat and human ortholog suggests the importance of the secondary structure of µ-protocadherin in its function.

After the mucin repeat in the long isoform, there is a single transmembrane region and a cytoplasmic region with a conserved tyrosine kinase phosphorylation site (blue) and four SH3 binding regions (red). In the short isoform, the cadherin ectodomains are alternatively spliced to the same transmembrane domain. The cytoplasmic region of rat µ-protocadherin terminates with a PSD95-Dlg-zona occludens-1 (PDZ) binding domain (orange, Fig. 2C) similar to the COOH-terminal end of rat fat protocadherin (27). Conserved amino acids are present at the 3'-end of the human form; however, further experimentation will be needed to validate whether it can mediate binding to a PDZ protein.

As a final note of evidence that the human ortholog of µ-protocadherin was identified, MUCDHL maps to 11p15.5, consistent with an analysis of synteny with distal mouse chromosome 7. The genomic structure of human µ-protocadherin is presented in Fig. 3. Three alternatively spliced forms of human µ-protocadherin were identified in the human kidney. The first two isoforms differ in the presence of the mucin domain similarly to that described for the rat ortholog (8). The third isoform (AF258675), interestingly, has a shortened 13th exon, lacks the mucin and transmembrane domain (TM in Fig. 3), and contains a unique cytoplasmic region. This isoform potentially could encode for a secreted form (the signal sequence is still present) or, alternatively, could be linked to the membrane by a glycosyl phosphatidylinositol (GPI) linkage, although the consensus sequence for GPI linkage was not detected. Although µ-protocadherin contains many similarities to the protocadherin superfamily (8), the above genomic analysis is in contrast to a large clustering of protocadherin genes in which the genomic sequences are organized in three closely linked clusters that contain variable extracellular domains but a conserved cytoplasmic region (29).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3.   Genomic structure of human µ-protocadherin. The exon-intron structure was obtained by pairwise alignment of the human ortholog (AF256874) and mRNAs (AF258676, AF276242, and AF258675). Lengths of the boxes are proportional to size of the exon. White boxes correspond to 5'- and 3'-untranslated regions (UTRs), respectively. For AF276242, the 5'-UTR structure was unreported.

Expression analysis of human µ-protocadherin. Tissue expression of human µ-protocadherin in fetal (Fig. 4A) and adult human tissue (Fig. 4B) was analyzed by Northern blot. Blots were hybridized with the cytoplasmic region of a homologous human mouse EST clone (GenBank accession no. 2299669). Three forms are noted in the developing kidney and liver. Interestingly, the longest isoform is primarily expressed in the adult small intestine and colon, whereas in the fetal liver, the strongest expression of the second message is noted. These differences in isoform-specific expression may relate to different stages of development. Although a third blot containing adult kidney tissue was negative using the same probe (data not shown), PCR-based analysis as well as the EST database reveals expression derived from the adult kidney. Interestingly, only a single major isoform is expressed in the adult small intestine and colon. Analysis by Western blot of fetal and adult kidney was performed next (Fig. 5). Rabbit antibody directed against a GST-fusion protein with the cytoplasmic domain of human µ-protocadherin was generated and used as the primary antibody. Preimmune serum was used as the negative control. No staining was seen with the preimmune serum (data not shown). In both the fetal and adult kidney, the rabbit polyclonal detected four forms ranging from 110 to 220 kd. These multiple forms may be the result of posttranslational modifications and highlight the need to explore the possible different functions of each isoform.


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of human µ-protocadherin transcripts in fetal and adult human tissues. Human fetal blot (A) and multiple adult human tissue Northern blot (Clontech; B) were hybridized with the cytoplasmic region of human µ-protocadherin (derived from GenBank accession no. AI640262), and 2 µg of polyA-rich mRNA/lane was loaded.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5.   Immunoblot analysis of fetal and adult kidneys. High-titer rabbit antiserum directed against the cytoplasmic domain of human µ-protocadherin was used as the primary antibody. Incubation with a peroxidase secondary antibody and subsequent enhanced chemiluminescence was performed. In both the fetal and the older kidney, the rabbit polyclonal detected 4 forms ranging from 110 to 220 kd.

Apical distribution of µ-protocadherin in differentiated epithelia. Immunocytochemistry in adult kidney revealed µ-protocadherin is expressed apically along the brush border of the proximal convoluted tubule (green, Fig. 6A) and excluded from cortical collecting ducts (red, Fig. 6A). µ-Protocadherin expression in proximal tubules was confirmed by dual staining with neutral endopeptidase (EC 3.4.24.11) a known brush-border enzyme (Fig. 6C). Colocalization of these two proteins is seen in Fig. 6D. Localization of this protein to the apical surface can be further demonstrated on transfection of MUCDHL into polarized MDCK cells. MDCK cells were plated onto Transwell filters and allowed to grow until they formed a tightly polarized monolayer. Cells were fixed and stained with anti-zona occludens-1 (tight junction, blue) and anti-µ-protocadherin antibodies (green), mounted in propidium iodide to detect nuclei, and analyzed by confocal microscopy (Fig. 7, A and B). The X-Z section (bottom) confirms the µ-protocadherin staining to be apical at or above the tight junction level (blue). This is in contrast to caco-2 cells that have not yet formed such a tightly polarized monolayer. Although some of the staining is apical, the majority is still cytoplasmic. These results demonstrate that human µ-protocadherin is compartmentalized to the apical surface as cells develop a polarized state and suggest it may have additional functions in terminally differentiated epithelia.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 6.   Immunolocalization of human-µ-protocadherin in adult kidneys. A: sections were dually stained with rabbit polyclonal antibodies against µ-protocadherin (green) and anti-cytokeratin antibodies (red), a marker for the kidney collecting duct. Bar = 30 µm. In a colocalization experiment, adult kidney was stained for µ-protocadherin (green; B) and neutral endopeptidase (EC 3.4.24.11), a known brush-border enzyme (red; C). Colocalization of these two proteins is seen when the two channels are merged (yellow; D). Bars B-D = 60 µm.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7.   Distribution of µ-protocadherin in transfected Madin-Darby canine kidney (MDCK) and Caco-2 cells. A: MDCK cells were transfected with the short isoform of human µ-protocadherin and analyzed for expression 2 days later. They were stained with anti-µ-protocadherin antibody (green), anti-zona occludens-1 monoclonal antibody (blue), and propidium iodide to detect nuclei (red). X-Z sections demonstrate an apical localization for µ-protocadherin. B: caco-2 cells that endogenously express µ-protocadherin were analyzed 4 days after seeding. In contrast to transfected MDCK cells, X-Z sections of caco-2 cells reveal that vesicles in the cytoplasm are also positive. C: MDCK cells were transfected with the mucin-containing isoform of the rat µ-protocadherin gene (7) and truncated forms lacking the COOH terminus (D) or NH2 terminus (E). A his tag on the COOH terminus of the fusion protein was utilized for identification of µ-protocadherin. Deletion of the NH2 terminus (E) disrupts apical targeting, and X-Z sections reveal µ-protocadherin now also localizes to the lateral membrane. Bars = 10 µm.

Extracellular domain required for targeting of µ-protocadherin to the apical surface. To analyze the sequences required for targeting of µ-protocadherin to the apical surface, truncated forms lacking the NH2 or COOH terminus were cloned into the pHM6 mammalian expression vector. All the forms contained the putative transmembrane domain for insertion into the membrane. A his tag on the COOH terminus of the fusion protein allowed for the identification of the protein. As illustrated in Fig. 7C, the mucin-containing isoform, similar to the shorter isoform in Fig. 7A, is directed to the apical surface. Because the former contains a His site at the COOH terminus, this demonstrates that the PDZ binding domain is not required in this system for targeting. Transfection of the truncated form lacking the COOH terminus was still capable of targeting to the apical surface (Fig. 7D). Deletion of the NH2 terminus, however, disrupted this targeting, and µ-protocadherin also localized to the lateral membrane (Fig. 7E). Thus the extracellular domain is required for targeting of µ-protocadherin to the apical surface.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The cadherin superfamily is composed primarily of six major subfamilies distinguished on the basis of their genomic structure, protein domain composition, and phylogenetic analysis (19). These include the classic or type-I cadherins, atypical or type-II cadherins, and protocadherins and their mouse counterparts, the cadherin-related neuronal receptors (10), desmocollins, desmogleins, and flamingo cadherins. In addition, isolated cadherin family members include cadherin-13, -15, -16, -17, Dachsous, RET, FAT, MEGF1, and most invertebrate cadherins. One unique identifying feature of µ-protocadherin is the juxtaposition of a cadherin domain followed by mucin repeats in its extracellular domain. This mucin-type region structure is conserved between rat and human and contains a 31 amino acid motif that is repeated 3.5 times. As was experimentally observed with the rat µ-protocadherin ortholog (8), neural network predictions of mucin-type GalNAc O-glycosylation sites in human µ-protocadherin are that they are heavily glycosylated (data not shown) (23). In both the rat and the human forms, the mucin region is alternatively spliced to generate a protein with an extracellular region consisting of just the cadherin ectodomains. In addition, the conservation of domain structures between the human and rat forms extend through the cytoplasmic region. After the extracellular domain, the human µ-protocadherin contains a single transmembrane region and a cytoplasmic region containing four SH3 binding regions, as in the rat µ-protocadherin gene. This is in contrast to that of human alpha -protocadherin, which contains six (29). The cytoplasmic tyrosine kinase phosphorylation site is conserved across the rat and human species. The cytoplasmic region of rat µ-protocadherin terminates with a type I PDZ binding domain, similar to the COOH-terminal end of rat fat protocadherin (22). Although conserved amino acids are present at the COOH-terminal end of the human form, further experimentation is needed to test whether it can mediate binding to a PDZ protein. Additional evidence that we indeed identified the ortholog is on the basis of mouse to human synteny and FISH analysis. A mouse BAC clone containing the µ-protocadherin gene localizes to mouse distal chromosome 7, which is syntenic to the human 11p15.5 region, the site of the MUCDHL gene. Thus the previously described MUCDHL gene is the human ortholog of µ-protocadherin and may represent a new subdivision within the cadherin superfamily.

A second unique feature of µ-protocadherin is its apical distribution in terminally differentiated epithelia. Structural information for apical sorting of the transmembrane neurotrophin receptors (p75) is localized to a juxtamembrane region of the extracellular domain that is rich in O-glycosylated serine/threonine residues (31), suggesting that the mucin repeats in µ-protocadherin may play a similar role. However, both the long and the short isoform of µ-protocadherin are targeted to the apical surface in polarized cells, suggesting that the mucin region is not required for targeting to the apical membrane. The NH2 terminus, however, is clearly essential, because a truncated form lacking it is targeted to the lateral membrane as well. Another potential sorting signal on µ-protocadherin is its PDZ binding domain at the COOH terminus. For example, the PDZ interacting domain of the cystic fibrosis transmembrane conductance regulator is required for functional expression in the apical plasma membrane (17). In contrast, the constructs reported here were fusion proteins with his tags masking the PDZ binding domain, revealing that the apical targeting was independent of such a signal. In a different mucin-like protein, endolyn, an N-glycan-dependent apical targeting signal in the lumenal domain, is responsible for direction to the apical surface of polarized epithelial cells, after which it is then processed to a novel biosynthetic pathway to lysosomes (11). Similarly, N-glycosylation sites located in the large extracellular loop of glycine transporter isoform-2 are involved in apical localization in polarized MDCK cells. (33). Thus future experiments will explore the potential role of the five N-glycosylation sites on the extracellular domain of µ-protocadherin in its apical targeting. It is of interest that the glycosyl phosphatidylinositol-linked T-cadherin is differentially targeted to the apical surface of the chick intestinal epithelium in vivo, suggesting the cadherin superfamily may have functional roles in addition to mediating cell-to-cell adhesion (13).

The multiplicity of µ-protocadherin isoforms suggests that this protocadherin subfamily may have several functional roles. The longer isoform (containing the mucin moiety) in rats was capable of mediating aggregation in L cells (8). Similar to other protocadherins, however, the aggregation was not as robust as that reported for E-cadherin (24). Preliminary experiments with the short isoform of human µ-protocadherin (lacking the mucin moiety) reveal it can mediate sorting of expressing cells from nonexpressing cells (data not shown). Because of the complex biological versatility of the sialomucins, a comparison between these two isoforms and their kinetics of aggregation may be more revealing. Mucins, for instance, have been shown to interfere with E-cadherin-mediated cell-to-cell adhesion (15). It is therefore possible that the mucin repeats on µ-protocadherin may regulate the adhesion mediated by the cadherin ectodomains. In addition, however, their oligosaccharide side chains, which protrude above the glycocalyx, can interact with ligands on opposing cells and facilitate cell-to-cell adhesion (26, 27). The glycosylation status of the cadherins also has a profound effect on the transduction of its signal into the cell. The addition of a bisecting N-acetylglucosamine residue on E-cadherin enhanced cell-to-cell aggregation, suppressing metastasis in B16 melanoma cells (32). The molecular mechanism was the downregulation of tyrosine phosphorylation on beta -catenin, resulting in decreased cell migration (12). Thus any functional analysis of µ-protocadherin will likely require the identification of its posttranslational modifications in vivo. The function of the third form, which splices out the mucin and transmembrane domain to combine a truncated fourth ectodomain to a unique 3'-end, requires further investigation. The potential exists that this protein could be secreted or, alternatively, could be attached to the membrane through a GPI linkage, although there is no apparent recognition sequence for the latter. Because both the probe for Northern blot analysis and the fusion protein generated for the production of the polyclonal antibodies were derived from the cytoplasmic sequences of the first two isoforms, the expression pattern of the third isoform remains to be determined.

The functional role for µ-protocadherin in vivo in the adult kidney is intriguing, because lateral expression of the molecule would more likely facilitate an adhesive interaction. One possibility is that while in an apical localization, the heavily negative sialated residues could serve in part to orient cells within a complex and facilitate aggregation through other cell adhesion molecules. µ-Protocadherin is not the only cadherin that localizes to the apical membrane. For example, in vivo, T-cadherin was detected on the apical cell surface of the chick intestinal epithelium (13). T-cadherin is a glycophosphoinositol-anchored protein noted to be found in specialized cell membrane domains rich in signaling molecules, termed lipid rafts (7). In vascular smooth muscle cells, T-cadherin was found to be associated with signal transducing effector molecules, such as SRC family kinases and Galpha s protein (21). Other cadherin superfamily members implicated as signaling molecules are the seven-transmembrane (7-TM) cadherins, such as starry night and flamingo in Drosophila (25) and the mammalian paralog human MEGF2 (18). 7-TM cadherins contain seven predicted transmembrane domains with high homology to G-protein-coupled receptors and thus could potentially regulate intracellular cAMP and cGMP levels. µ-Protocadherin contains proline-rich regions in its cytoplasmic domain that may interact with SH3 domains in nonreceptor tyrosine kinases; therefore, a role for µ-protocadherin in cell signaling will be explored.

A second cadherin molecule localizing to the apical membrane is human peptide transporter-1 (5). Human peptide transporter-1, which has an affinity for dipeptides, is associated with intestinal peptide transport and contains four cadherin-like domains in its extracellular region, similar to that seen in µ-protocadherin. The ability of a cadherin to directly function as a ligand-specific receptor is perhaps best illustrated by the protocadherin ret, which binds GDNF. Recent molecular modeling of the RET sequence again delineated four distinct NH2-terminal domains, each of ~110 residues, containing many of the consensus motifs of the cadherin fold (2). µ-Protocadherin that is expressed on the brush border of the proximal tubule, therefore, would be ideally situated to function as a ligand-specific receptor for a molecule filtered by the glomerulus.

Cadherins are critical for processes such as embryonic patterning, maintenance of tissue integrity, generation of three-dimensional structure, and control of cell growth. The human µ-protocadherin gene maps to 11p15.5, an imprinting region (6). This region also contains loss of heterozygosity regions in Wilms tumors and the locus of Beckwith-Wiedmann syndrome (a congenital anomaly consisting of somatic overgrowth, urogenital abnormalities, and a predisposition to development of tumors). The identification of the human ortholog of µ-protocadherin is the first step in studying its role in kidney development and disease.


    ACKNOWLEDGEMENTS

We thank Richard Friedman for help in bioinformatics of the µ-protocadherin sequence. We are also grateful to Qais Al-Awqati for a critical review of this manuscript.


    FOOTNOTES

This work was funded by National Institute of Diabetes and Digestive and Kidney Diseases Grant 5-PO1-DK55388, a March of Dimes award, and the Spunk Fund (to M. Goldberg).

Address for reprint requests and other correspondence: M. Goldberg, BHS Rm. 724, Dept. of Pediatrics, College of Physicians and Surgeons, Columbia Univ., 3959 Broadway, New York, NY 10032 (E-mail: mg81{at}columbia.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

March 29, 2002;10.1152/ajprenal.00012.2002

Received 10 January 2002; accepted in final form 11 March 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Al-Awqati, Q, and Goldberg MR. Architectural patterns in branching morphogenesis in the kidney. Kidney Int 54: 1832-1842, 1998[ISI][Medline].

2.   Anders, J, Kjar S, and Ibanez CF. Molecular modeling of the extracellular domain of the RET receptor tyrosine kinase reveals multiple cadherin-like domains and a calcium-binding site. J Biol Chem 276: 35808-35817, 2001[Abstract/Free Full Text].

3.   Berg, EL, McEvoy LM, Berlin C, Bargatze RF, and Butcher EC. L-selectin-mediated lymphocyte rolling on MAdCAM-1. Nature 366: 695-698, 1993[Medline].

4.   Choe, EA, Patterson LT, Brookhiser WT, Mah S, Kintner C, and Dressler GR. Differential expression and function of cadherin-6 during renal epithelium development. Development 125: 803-812, 1998[Abstract].

5.   Dantzig, AH, Hoskins JA, Tabas LB, Bright S, Shepard RL, Jenkins IL, Duckworth DC, Sportsman JR, Mackensen D, Rosteck PR, Jr, and Skatrud PL. Association of intestinal peptide transport with a protein related to the cadherin superfamily. Science 264: 430-433, 1994[Abstract/Free Full Text].

6.   Dao, D, Walsh CP, Yuan L, Gorelov D, Feng L, Hensle T, Nisen P, Yamashiro DJ, Bestor TH, and Tycko B. Multipoint analysis of human chromosome 11p15/mouse distal chromosome 7: inclusion of H19/IGF2 in the minimal WT2 region, gene specificity of H19 silencing in Wilms' tumorigenesis and methylation hyper-dependence of H19 imprinting. Hum Mol Genet 8: 1337-1352, 1999[Abstract/Free Full Text].

7.   Doyle, DD, Goings GE, Upshaw-Earley J, Page E, Ranscht B, and Palfrey HC. T-cadherin is a major glycophosphoinositol-anchored protein associated with noncaveolar detergent-insoluble domains of the cardiac sarcolemma. J Biol Chem 273: 6937-6943, 1998[Abstract/Free Full Text].

8.   Goldberg, M, Peshkovsky C, Shifteh A, and Al-Awqati Q. µ-Protocadherin, a novel developmentally regulated protocadherin with mucin-like domains. J Biol Chem 275: 24622-24629, 2000[Abstract/Free Full Text].

9.   Gumbiner, BM. Regulation of cadherin adhesive activity. J Cell Biol 148: 399-404, 2000[Abstract/Free Full Text].

10.   Hamada, S, and Yagi T. The cadherin-related neuronal receptor family: a novel diversified cadherin family at the synapse. Neurosci Res 41: 207-215, 2001[ISI][Medline].

11.   Ihrke, G, Bruns JR, Luzio JP, and Weisz OA. Competing sorting signals guide endolyn along a novel route to lysosomes in MDCK cells. EMBO J 20: 6256-6264, 2001[ISI][Medline].

12.   Kitada, T, Miyoshi E, Noda K, Higashiyama S, Ihara H, Matsuura N, Hayashi N, Kawata S, Matsuzawa Y, and Taniguchi N. The addition of bisecting N-acetylglucosamine residues to E-cadherin down-regulates the tyrosine phosphorylation of beta-catenin. J Biol Chem 276: 475-480, 2001[Abstract/Free Full Text].

13.   Koller, E, and Ranscht B. Differential targeting of T- and N-cadherin in polarized epithelial cells. J Biol Chem 271: 30061-30067, 1996[Abstract/Free Full Text].

14.   Le, TL, Yap AS, and Stow JL. Recycling of E-cadherin: a potential mechanism for regulating cadherin dynamics. J Cell Biol 146: 219-232, 1999[Abstract/Free Full Text].

15.   Ligtenberg, M, Buijs JL, Vos F, and Hilkens J. Suppression of cellular aggregation by high levels of episialin. Cancer Res 52: 2318-2324, 1992[Abstract/Free Full Text].

16.   Mahoney, PA, Weber U, Onofrechuk P, Biessmann H, Bryant PJ, and Goodman CS. The fat tumor suppressor gene in Drosophila encodes a novel member of the cadherin gene superfamily. Cell 67: 853-868, 1991[ISI][Medline].

17.   Moyer, BD, Duhaime M, Shaw C, Denton J, Reynolds D, Karlson KH, Pfeiffer J, Wang S, Mickle JE, Milewski M, Cutting GR, Guggino WB, Li M, and Stanton BA. The PDZ-interacting domain of cystic fibrosis transmembrane conductance regulator is required for functional expression in the apical plasma membrane. J Biol Chem 275: 27069-27074, 2000[Abstract/Free Full Text].

18.   Nakayama, M, Nakajima D, Nagase T, Nomura N, Seki N, and Ohara O. Identification of high molecular-weight proteins with multiple EGF-like motifs by motif-trap screening. Genomics 51: 27-34, 1998[ISI][Medline].

19.   Nollet, F, Kools P, and van Roy F. Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol 299: 551-572, 2000[ISI][Medline].

20.   Paris, MJ, and Williams BR. Characterization of a 500-kb contig spanning the region between c-Ha-Ras and MUC2 on chromosome 11p15.5. Genomics 69: 196-202, 2000[ISI][Medline].

21.   Philippova, MP, Bochkov VN, Stambolsky DV, Tkachuk VA, and Resink TJ. T-cadherin and signal-transducing molecules co-localize in caveolin-rich membrane domains of vascular smooth muscle cells. FEBS Lett 429: 207-210, 1998[ISI][Medline].

22.   Ponassi, M, Jacques TS, Ciani L, and ffrench-Constant C. Expression of the rat homologue of the Drosophila fat tumour suppressor gene. Mech Dev 80: 207-212, 1999[ISI][Medline].

23.   Gupta, R, Birch H, Rapacki K, Brunak S, and Hansen JE. O-GLYCBASE version 4.0: a revised database of O-glycosylated proteins. Nucleic Acids Res 27: 370-372, 1999[Abstract/Free Full Text].

24.   Sano, K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, and Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J 12: 2249-2256, 1993[ISI][Medline].

25.   Usui, T, Shima Y, Shimada Y, Hirano S, Burgess RW, Schwarz TL, Takeichi M, and Uemura T. Flamingo, a seven-pass transmembrane cadherin, regulates planar cell polarity under the control of Frizzled. Cell 98: 585-595, 1999[ISI][Medline].

26.   Van Klinken, BJ, Dekker J, Buller HA, and Einerhand A. Mucin gene structure, and expression: protection vs. adhesion. Am J Physiol Gastrointest Liver Physiol 269: G613-G627, 1995[Abstract/Free Full Text].

27.   Watt, SM, Bühring H-J, Rappold I, Chan J Y-H, Lee-Prudhoe J, Jones T, Zannettino ACW, Simmons PJ, Doyonnas R, Sheer D, and Butler LH. CD164, a novel sialomucin on CD34+ and erythroid subsets, is located on human chromosome 6q21. Blood 92: 849-866, 1998[Abstract/Free Full Text].

28.   Wizenmann, A, and Lumsden A. Segregation of rhombomeres by differential chemoaffinity. Mol Cell Neurosci 9: 448-459, 1997[ISI][Medline].

29.   Wu, Q, and Maniatis T. A striking organization of a large family of human neural cadherin-like cell adhesion genes. Cell 97: 779-790, 1999[ISI][Medline].

30.   Yap, AS, Brieher WM, and Gumbiner BM. Molecular and functional analysis of cadherin-based adherens junctions. Annu Rev Cell Dev Biol 13: 119-146, 1997[ISI][Medline].

31.   Yeaman, C, Le Gall AH, Baldwin AN, Monlauzeur L, Le Bivic A, and Rodriguez-Boulan E. The O-glycosylated stalk domain is required for apical sorting of neurotrophin receptors in polarized MDCK cells. J Cell Biol 139: 929-940, 1997[Abstract/Free Full Text].

32.   Yoshimura, M, Ihara Y, Matsuzawa Y, and Taniguchi N. Aberrant glycosylation of E-cadherin enhances cell-cell binding to suppress metastasis. J Biol Chem 271: 13811-13815, 1996[Abstract/Free Full Text].

33.   Zafra, F, and Gimenez C. Molecular determinants involved in the asymmetrical distribution of glycine transporters in polarized cells. Biochem Soc Trans 29: 746-750, 2001[ISI][Medline].


Am J Physiol Renal Fluid Electrolyte Physiol 283(3):F454-F463
0363-6127/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Toxicol SciHome page
J. Jiang, D. Dean, R. C. Burghardt, and A. R. Parrish
Disruption of Cadherin/Catenin Expression, Localization, and Interactions During HgCl2-Induced Nephrotoxicity
Toxicol. Sci., July 1, 2004; 80(1): 170 - 182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/F454    most recent
00012.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goldberg, M.
Right arrow Articles by Warburton, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goldberg, M.
Right arrow Articles by Warburton, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online