|
|
||||||||
Departments of 1 Biological Chemistry and 3 Molecular Genetics, The Weizmann Institute of Science, Rehovot 76100, Israel; and 2 Department of Anatomy, Physiology and Health Education, Novosibirsk State Pedagogical University, Russian Federation
| |
ABSTRACT |
|---|
|
|
|---|
Corticosteroid hormone-induced factor
(CHIF) is a short epithelial-specific protein that is independently
induced by aldosterone and a high-K+ diet. It is a member
of the FXYD family of single-span transmembrane proteins that include
phospholemman, Mat-8, and the
-subunit of
Na+-K+-ATPase. A number of studies have
suggested that these proteins are involved in the regulation of ion
transport and, in particular, functionally interact with the
Na+-K+-ATPase. The present study describes the
characterization, targeted disruption, and phenotypic analysis of the
mouse CHIF gene. The CHIF knockout mice are viable and not
distinguishable from wild-type littermates under normal conditions.
Under K+ loading, they have a twofold higher urine volume
and an increased glomerular filtration rate. Similar but smaller
effects are observed in mice fed a low-Na+ diet. Treating
K+-loaded mice for 10 days with furosemide resulted in
lethality in the knockout mice (17 of 39) but not in the wild-type
group (1 of 39). The data are consistent with an effect of CHIF on the Na+-K+-ATPase that is specific to the outer and
inner medullary duct, its major expression site.
FXYD proteins; sodium-potassium-adenosine-5'-triphosphatase;
-subunit; furosemide; corticosteroid hormone-induced factor; aldosterone
| |
INTRODUCTION |
|---|
|
|
|---|
CORTICOSTEROID
HORMONE-INDUCED factor (CHIF) is a 6.5-kDa transmembrane protein
cloned as an epithelial-specific, aldosterone-induced transcript
(2, 6, 18, 23). It is a member of a new gene family termed
after the invariant motif FXYD (19). The family consists
of seven single-span membrane proteins, four of which have been
reported to be involved in the regulation or mediation of ion
transport. They are FXYD 1 (phospholemman) (15), FXYD 2 (the
-subunit of Na+-K+-ATPase)
(12), FXYD 3 (Mat-8) (13), and FXYD 4 (CHIF)
(2).
The following observations suggest that CHIF plays a role in renal and intestinal electrolyte homeostasis. First, both its mRNA and protein are specifically expressed in kidney collecting duct [cortical collecting duct < outer medullary collecting duct < inner medullary collecting duct (IMCD)] and in distal colon surface cells (top 20% of the crypt) (6, 18, 23). They cannot be detected in many other epithelial and nonepithelial tissues, including other segments of the kidney tubule and intestine, lung, stomach, uterus, mammary gland, salivary gland, heart, brain, muscle, liver, or skin. Second, CHIF appears to be independently upregulated by low-Na+ intake via changes in plasma aldosterone and by high-K+ intake, independently of aldosterone (6, 18, 23, 24).
The
-subunit of the Na+-K+-ATPase (FXYD 2)
is the best-studied member of the above family. This 65-amino acid type
I membrane protein associates with the 
complex and is
specifically expressed in the kidney (4, 12, 21).
Functional effects of the
-subunit on pump kinetics have been
demonstrated by either coexpressing it with
and
in
Xenopus laevis oocytes and transfected mammalian cells or
neutralizing interactions in native kidney membranes using a specific
anti-
antibody (1, 4, 16, 21, 22). Recently, it has
been demonstrated that CHIF also interacts with the
Na+-K+-ATPase. First, it was found to be
localized in the basolateral membrane and it coprecipitated with the
-subunit under conditions that preserve active pump conformation
(7, 18). Second, coexpressing CHIF with the
-subunit in
X. laevis oocytes increased the Na+ affinity of
the pump and decreased its apparent K+ affinity, due to an
increased competition by Na+ at external binding sites
(3). A phospholemman-like protein, too, was reported to
interact with the
-subunit and to mediate its regulation by protein
kinase C (PKC) in shark rectal gland (10). Thus it appears
that, like
, CHIF and other FXYD proteins may function to modulate
pump kinetics in different tissues and maintain active Na+
and K+ pumping rates under varying conditions in the cell
(ATP, Na+, K+, phosphorylation, etc).
Comprehensive analysis of the role of CHIF and other FXYD proteins in body electrolyte homeostasis requires suitable animal models. The present study describes the generation and phenotypic analysis of a targeted null mutation of the CHIF gene. The mutants show two abnormalities: 1) an increased urine volume under Na+ deprivation and K+ loading and 2) lethality after a combination of high-K+ intake and furosemide injection. These observations are consistent with a role of CHIF in Na+ and K+ transport that is specific to the outer and inner medullary duct.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of a CHIF null mutant. Mice deficient in CHIF protein were generated by a targeted gene disruption. The CHIF gene was isolated by screening a mouse S129/SvJ phage genomic library with a rat cDNA probe. A ~20-kb clone was characterized by restriction mapping and partial sequencing. A 6.6-kb fragment that contains the whole transcribed region was fully sequenced and deposited in public databases under accession number AF362729. CHIF's coding sequence was disrupted by replacing a DNA fragment containing exons 3-5 (amino acids 1-33) with a neomycin (neo)-resistant cassette. The cassette was composed of neomycin phosphotransferase (accession no. U32991) flanked by 5'- and 3'-regulatory regions of mouse phosphoglycerate kinase (accession nos. X15339 and X15340, respectively). The insertion also eliminated a DraII site at position 4752, used for genotypic analysis. A herpes simplex virus thymidine kinase gene cassette was introduced in the 5'-end of the construct, resulting in homologous DNA arms of ~7 and ~1 kb.
Embryonic stem cells (R1) were transfected with linearized plasmid by electroporation and cultivated on a layer of mouse embryo fibroblasts on gelatin-coated plates. Selection was done with 200 µg/ml G418 plus 2 µM gancyclovir. G418- and gancyclovir-resistant clones were collected, further cultivated, and analyzed by Southern blotting (see below). Chimeric mice were generated by aggregation as described elsewhere (14). Morulas were obtained from MF1 mice, and the aggregates were transferred to the uterus of CD1 pseudopregnant females. Chimeric males were identified by coat color and bred with MF1 females. Germline transmission was detected by PCR and reconfirmed by Southern blotting of tail DNA. For PCR, an ~1,000-bp fragment was amplified using the primers AGATCTATAGATCTCTCGTGGG (within the 3'-region of the neo cassette) and CCTTCCTGCATTCCACC (nucleotides 5730-5746 of the CHIF gene, located outside the targeting construct). The amplified fragment was also sequenced to verify proper recombination. For Southern blotting, genomic DNA was digested with DraII and hybridized to a probe corresponding to nucleotides 5650-6099 of the CHIF gene (located outside the targeting construct). The predicted sizes of the hybridizing fragments in the original and disrupted genes are 1.5 and 3.2 kb, respectively. Disruption of CHIF was further analyzed by Northern and Western blotting (see below). Wild-type and homozygous littermates were used to establish matched colonies of +/+ and
/
mice used in physiological assays.
Northern and Western hybridizations.
Mice were killed by cervical dislocation, and distal colons and kidneys
were excised and rinsed in ice-cold PBS. Kidneys were dissected into
cortex, medulla, and papilla, and microsomal membranes were prepared as
described before (8). Distal colon surface cells
(colonocytes) were isolated by a modification of the procedure described elsewhere (17). In brief, colonic tubes were
flushed three times with 10 ml of ice-cold PBS+2 mM dithiothreitol
(DTT) and inverted (lumen out). The inverted colons were tied at one end, filled with DMEM+10% FCS, 2 mM DTT, and 2 mM EDTA and then tied
at the other end as well. The filled colons were suspended in 25 ml of
the above DMEM-EDTA medium and incubated at 37°C for 40 min under
shaking at 140 rpm. Colonocytes were collected from the medium by
centrifugation and stored at
70°C. Colonic and kidney total RNA was
extracted as described before (23). Northern hybridization
was carried out using a [32P]-labeled cDNA probe prepared
from a mouse CHIF expressed sequence tag (EST) clone (accession no.
aa874059). For Western hybridization, a rabbit polyclonal antibody was
raised against the synthetic peptide CKATPLIIPGSANT (amino acids
75-87 of the mouse protein) coupled to keyhole limpet hemocyanin
through its NH2-terminal cysteine. Kidney microsomal
membranes and colonocyte whole cell lysates were resolved on a 10%
tricine gel, blotted with the above anti-sera (1:200), and overlaid
with horseradish peroxidase-coupled goat-anti rabbit antibody.
Animal treatment and metabolic cage studies.
Monitoring of water uptake and urine excretion was done in metabolic
cages. A typical experiment consisted of two matched groups of
12-18 +/+ and
/
mice weighing 30-40 g with an equal number of males and females. Mice were placed in metabolic cages (3 mice/cage) and acclimated for 10 days before the experiment. They were
first fed a regular diet (6.8 g K+/kg, 2.3 g
Na+/kg, 1.65 g Cl
/kg), and the following
measurements were performed daily: body weight, water and food intake,
and urine volume. They were then fed either a high-KCl diet (94.1 g
K+/kg, 2.3 g Na+/kg, 81.1 g
Cl
/kg) or an Na+-deficient diet (2.5 g
K+/kg, <0.01 g Na+/kg, 1.57 g
Cl
/kg) and monitored for an additional 7-10 days.
Experiments were conducted in conformity with the Guiding Principles
for Research Involving Animals and Human Beings and were supervised by
the Animal Welfare Committee of the Weizmann Institute. Urine and blood
sera were analyzed for K+ and Na+ content,
osmolality, and creatinine concentration. Electrolyte concentrations
were measured by atomic absorption spectroscopy (Spectra-AA-50) and
osmolarity with a vapor pressure osmometer (Wescor). Blood and urine
creatinine levels were measured with a commercial kit (Sigma
Diagnostics, St. Louis, MO) and used to calculate the glomerular
filtration rates (GFR). Plasma aldosterone was determined using a
radioimmunoassay kit (Coat-a-Count Aldosterone; DGP, Los Angeles, CA).
| |
RESULTS |
|---|
|
|
|---|
CHIF gene structure and the generation of knockout mice.
CHIF has been cloned and sequenced before only from rats. The mouse
mRNA and protein sequences were deduced by assembling 26 EST entries
and resequencing one of them, which was found to be identical to one
reported previously (19). Figure
1A depicts the predicted amino
acid sequence of mouse CHIF. It shares 85% identity with the
previously cloned rat protein and has the same membrane topology. The
corresponding cDNA has no stop codon upstream of the first AUG. Hence,
it may in principle represent a longer protein than the one depicted in
Fig. 1A. However, its homology to phospholemman and the
-subunit of Na+-K+- ATPase, which were
sequenced at the protein level (9, 15), makes this
possibility unlikely.
|
-subunit of
Na+-K+-ATPase (11, 20). Lack of
other similar CHIF sequences in the mouse genome was verified by
Southern blotting. Genomic mouse DNA was digested with four different
restriction enzymes and hybridized to a 2-kb probe that corresponds to
most of the coding sequence. In all cases, the probe hybridized only to
DNA fragments, the sizes of which are predicted by the cloned sequence
(Fig. 1D).
|
mice were
identified by Southern blotting of tail DNA and bred to produce
/
mice (Fig. 2A). Deletion of
CHIF mRNA and protein was further confirmed by Northern and Western
hybridizations (Fig. 2, B and C). In +/+ mice,
the anti-CHIF antibody blotted an ~6.5-kDa protein present in kidney
and distal colon. In agreement with previous studies (18),
the abundance of this protein was strongly elevated by
low-Na+ intake but not by a high-K+ diet (Fig.
2C). This 6.5-kDa band could not be detected in
/
mice
under any of these conditions.
|
Phenotypic analysis of knockout mice.
CHIF
/
mice were viable and fertile and could not be
distinguished from +/+ or +/
littermates by visual inspection. Under normal conditions, they showed slightly higher water and food intake,
but nevertheless were ~15% smaller than matched +/+ mice (Table
2). Because CHIF is primarily expressed
in kidney and is regulated by salt intake, we have looked for
phenotypes associated with kidney function under normal and electrolyte
stress conditions. Figures 3 and
4 summarize an experiment in which
matched groups of 12 +/+ and 12
/
mice were studied, first under
normal conditions and then during K+ loading. The high-KCl
diet increased their K+ intake by ~13-fold, with
no change in Na+ intake (Table
3). Under normal conditions, either no or
small differences were observed between the two groups. K+
loading resulted in substantial differences in two parameters. The
first was the volume of urine excreted, and the second was the GFR. The
high-K+ diet increased urine output in both wild-type and
knockout mice, but urine volume in
/
mice was up to twofold higher
than in the matched +/+ group (Fig. 3). The higher urine excretion was matched by an increased water intake so that the ratio of water intake
to excretion was not significantly different in +/+ and
/
mice
(Fig. 4A). The fractional Na+ and K+
excreted in the urine were similar as well. Because GFR changed significantly during high-K+ treatment, we have also
calculated the rates of water reabsorption and Na+ and
K+ excretion as a fraction of GFR. As above, no significant
difference has been noted between +/+ and
/
mice (Table
4). Also, no significant differences
between +/+ and
/
mice were observed in plasma Na+ and
K+ concentrations, aldosterone levels, and osmolality (Fig.
4B, Table 3).
|
|
|
|
|
1 · h
1 to practically zero, and
K+ intake was reduced by about one-half (Table 3). This
treatment also evoked an up to twofold difference in urine output
between
/
and +/+ mice (Fig. 5). In
this case, the difference was transient and not accompanied by profound
differences in GFR. The excreted and plasma K+ and
Na+ were similar as well (Fig.
6, Table 4). However, in
/
mice it
appeared that under low-Na+ intake, plasma Na+
was significantly reduced (124 ± 2 vs. 137 ± 3 mM,
P < 0.02).
|
|
/
mice (Fig. 7A). In the second form, mice were fed a regular diet and furosemide (1.5 mg/ml) was
included in their drinking water. The inhibition of NaCl absorption in
the thick ascending limb of Henle led to a marked diuresis, and the
excreted urine volume was transiently higher in CHIF
/
mice (Fig.
7B). Thus the observed increase in urine volume
appears to be linked to modulations in ion transport. To further assess this issue, we examined the combined effect of K+ loading
and furosemide. The combined stress was well tolerated by wild-type
mice, and 38 of 39 survived a 10-day treatment. In the knockout group,
substantial lethality was noted and 44% of them died during this
period (Fig. 8). Effects of the above
manipulations on plasma electrolytes and osmolarity are summarized in
Table 5. As expected, the
high-K+ intake elevated plasma K+ and the
sucrose diet lowered plasma osmolarity. The combined stress of high
K+ and furosemide resulted in hyperkalemia, which was more
severe in the
/
mice and was probably the reason for lethality in
these mice.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study describes the generation and phenotypic
analysis of a targeted mutation of the CHIF gene. Sequencing of the
mouse CHIF gene revealed the existence of nine exons, two of which
transcribe a 5'-untranslated region. This is quite unexpected for a
very small mRNA (0.55 kb) and protein (88 amino acids). However, a
similar multiexonic structure has been reported for two other members
of the FXYD family, phospholemman and the
-subunit of
Na+-K+-ATPase (5, 11, 20). The
obvious advantage of such genomic organization would be to enable
expression of alternatively spliced products. Two
-splice variants,
with different extracellular sequences, and localization along the
nephron have indeed been reported (9, 16, 19).
Phospholemman also appears to have several splice variants
(5), which differ only in the 5'-untranslated region, and
their expression could be differentially regulated. So far,
alternatively spliced forms of CHIF have not been detected experimentally. EST entries that deviate from the consensus mRNA sequence have been deposited in public databases, but they do not
appear to represent alternatively spliced forms of the above gene.
Deletion of the CHIF gene was done by standard methods and
confirmed by Southern, Northern, and Western hybridizations. The homozygous mutants appeared normal in most parameters measured. The
major phenotype observed is a larger volume of urine excretion (and
water intake) under conditions of K+ loading or
Na+ deprivation. Such an abnormality is consistent with the
high abundance of CHIF in the IMCD, a major site in regulating water homeostasis. The fact that the phenotype is apparent during electrolyte stress but not when diuresis is evoked by excessive water intake suggests a secondary response mediated by alterations in
Na+ and K+ transport. It has been recently
demonstrated that CHIF interacts with the
Na+-K+-ATPase and increases its affinity to
cell Na+ while decreasing its apparent K+
affinity (3, 7). The last effect is due to an increased competition by Na+ at external K+ binding
sites. One may therefore predict that the deletion of CHIF will affect
pump kinetics and partly inhibit collecting duct K+
excretion and/or Na+ absorption. This may not directly
affect electrolyte homeostasis because inhibition is only partial and
probably well compensated for by the increased GFR and elevated
transport rates in the more proximal nephron segments. The observed
increase in water excretion may therefore reflect either the elevated
GFR under K+ loading or a secondary response of the IMCD to
the inhibited Na+/K+ transport. However, a
defect in K+ secretion could be noted when K+
loading was combined with the inhibition of NaCl absorption by furosemide. Under these conditions, 44% of the
/
mice died within 10 days, and the rest were hyperkalemic relative to the +/+ mice. While
this phenomenon demonstrates an essential role of CHIF under these
stress conditions, its molecular mechanism is not obvious. In
principle, it may reflect either an excessive volume depletion or
inhibition of K+ excretion, which becomes lethal in the
/
mice. Plasma K+ and osmolarity measurements
summarized in Table 5 indicate that the second possibility is the more
likely one.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Ahuva Knyszynski and Tatyana Burakov for help in generating the knockout mice.
| |
FOOTNOTES |
|---|
* R. Aizman and C. Asher contributed equally to this work.
This study was supported by research grants from the Minerva Foundation (H. Garty and S. J. D. Karlish) and the Crown Endowment Fund (to H. Garty).
Address for reprint requests and other correspondence: H. Garty, Dept. of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100 Israel (E-mail: h.garty{at}weizmann.ac.il).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
March 19, 2002;10.1152/ajprenal.00376.2001
Received 26 December 2001; accepted in final form 13 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arystarkhova, E,
Wetzel RK,
Asinovski NK,
and
Sweadner KJ.
The gamma subunit modulates Na+ and K+ affinity of the renal Na,K-ATPase.
J Biol Chem
274:
33183-33185,
1999
2.
Attali, B,
Latter H,
Rachamim N,
and
Garty H.
A corticosteroid-induced gene expressing an "IsK-like" K+ channel activity in Xenopus oocytes.
Proc Natl Acad Sci USA
92:
6092-6096,
1995
3.
Béguin, P,
Crambert G,
Guennoun S,
Garty H,
Horisberger JD,
and
Geering K.
CHIF, a member of the FXYD protein family, is a regulator of Na,K-ATPase distinct from the gamma subunit.
EMBO J
20:
3993-4002,
2001[ISI][Medline].
4.
Beguin, P,
Wang XY,
Firsov D,
Puoti A,
Claeys D,
Horisberger JD,
and
Geering K.
The gamma subunit is a specific component of the Na,K-ATPase and modulates its transport function.
EMBO J
16:
4250-4260,
1997[ISI][Medline].
5.
Bogaev, RC,
Jia L,
Kobayashi YM,
Palmer CJ,
Mounsey JP,
Moorman JR,
Jones LR,
and
Tucker AL.
Gene structure and expression of phospholemman in mouse.
Gene
271:
69-79,
2001[ISI][Medline].
6.
Capurro, C,
Bonvalet JP,
Escoubet B,
Garty H,
and
Farman N.
Cellular localization and regulation of CHIF in kidney and colon.
Am J Physiol Cell Physiol
271:
C753-C762,
1996
7.
Garty H, Lindzen M, Scanzano R, Aizman R, Fuzesi M, Carradus M,
Goldschleger R, Farman N, Blostein R, and Karlish SJD. A specific
functional interaction between CHIF and Na,K-ATPase. Implication for
regulation by FXYD. Am J Physiol Renal Physiol (April
16, 2002). 10.1152/ajprenal.00112.2002.
8.
Jorgensen, PL.
Purification of Na+,K+-ATPase: enzyme sources, preparative problems, and preparation from mammalian kidney.
Methods Enzymol
156:
29-43,
1988[ISI][Medline].
9.
Kuster, B,
Shainskaya A,
Pu HX,
Goldshleger R,
Blostein R,
Mann M,
and
Karlish SJ.
A new variant of the gamma subunit of renal Na,K-ATPase. Identification by mass spectrometry, antibody binding, and expression in cultured cells.
J Biol Chem
275:
18441-18446,
2000
10.
Mahmmoud, YA,
Vorum H,
and
Cornelius F.
Identification of a phospholemman-like protein from shark rectal glands. Evidence for indirect regulation of na,k-ATPase by protein kinase c via a novel member of the FXYDY family.
J Biol Chem
275:
35969-35977,
2000
11.
Meij, IC,
Koenderink JB,
van Bokhoven H,
Assink KF,
Tiel Groenestege W,
de Pont JJ,
Bindels RJ,
Monnens LA,
van Den Heuvel LP,
and
Knoers NV.
Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase gamma-subunit.
Nat Genet
26:
265-266,
2000[ISI][Medline].
12.
Mercer, RW,
Biemesderfer D,
Bliss DP,
Collins JH,
and
Forbush B.
Molecular cloning and immunological characterization of the gamma polypeptide, a small protein associated with the Na,K-ATPase.
J Cell Biol
121:
579-586,
1993
13.
Morrison, BW,
Moorman JR,
Kowdley GC,
Kobayashi YM,
Jones LR,
and
Leder P.
Mat-8, a novel phospholemman-like protein expressed in human breast tumors, induces a chloride conductance in Xenopus oocytes.
J Biol Chem
270:
2176-2182,
1995
14.
Nagy, A,
and
Rossant J.
Production of completely ES cell derived fetuses.
In: Gene Targeting: A Practical Approach, edited by Joyner AL.. Oxford, UK: Oxford University Press, 1993, p. 147-179.
15.
Palmer, CJ,
Scott BT,
and
Jones LR.
Purification and complete sequence determination of the major plasma membrane substrate for cAMP-dependent protein kinase and protein kinase C in myocardium.
J Biol Chem
266:
11126-11130,
1991
16.
Pu, HX,
Cluzeaud F,
Goldshleger R,
Karlish SJD,
Farman N,
and
Blostein R.
Functional role and immunocytochemical localization of the
a and
b forms of the Na,K-ATPase
subunit.
J Biol Chem
276:
20370-20378,
2001
17.
Schwartz, B,
Avivi C,
and
Lamprecht SA.
Isolation and characterization of normal and neoplastic colonic epithelial cell populations.
Gastroenterology
100:
692-702,
1991[ISI][Medline].
18.
Shi, HK,
Levy-Holzman R,
Cluzeaud F,
Farman N,
and
Garty H.
Membrane topology and immunolocalization of CHIF in kidney and intestine.
Am J Physiol Renal Physiol
280:
F505-F515,
2001
19.
Sweadner, KJ,
and
Rael E.
The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression.
Genomics
68:
41-56,
2000[ISI][Medline].
20.
Sweadner, KJ,
Wetzel RK,
and
Arystarkhova E.
Genomic organization of the human FXYD2 gene encoding the gamma subunit of the Na,K-ATPase.
Biochem Biophys Res Commun
279:
196-201,
2000[ISI][Medline].
21.
Therien, AG,
Goldshleger R,
Karlish SJD,
and
Blostein R.
Tissue-specific distribution and modulatory role of the gamma subunit of the Na,K-ATPase.
J Biol Chem
272:
32628-32634,
1997
22.
Therien, AG,
Karlish SJ,
and
Blostein R.
Expression and functional role of the gamma subunit of the Na, K-ATPase in mammalian cells.
J Biol Chem
274:
12252-12256,
1999
23.
Wald, H,
Goldstein O,
Asher C,
Yagil Y,
and
Garty H.
Aldosterone induction and epithelial distribution of CHIF.
Am J Physiol Renal Fluid Electrolyte Physiol
271:
F322-F329,
1996
24.
Wald, H,
Popovtzer MM,
and
Garty H.
Differential regulation of CHIF expression by aldosterone and potassium.
Am J Physiol Renal Physiol
272:
F617-F623,
1997
This article has been cited by other articles:
![]() |
I. Lubarski, S. J. D. Karlish, and H. Garty Structural and functional interactions between FXYD5 and the Na+-K+-ATPase Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1818 - F1826. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Cai, M. Keck, M. R. McReynolds, J. D. Klein, K. Greer, K. Sharma, J. B. Hoying, J. M. Sands, and H. L. Brooks Effects of water restriction on gene expression in mouse renal medulla: identification of 3betaHSD4 as a collecting duct protein Am J Physiol Renal Physiol, July 1, 2006; 291(1): F218 - F224. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Geering FXYD proteins: new regulators of Na-K-ATPase Am J Physiol Renal Physiol, February 1, 2006; 290(2): F241 - F250. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M C Connell and E. Davies The new biology of aldosterone J. Endocrinol., July 1, 2005; 186(1): 1 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qi, I. Whitt, A. Mehta, J. Jin, M. Zhao, R. C. Harris, A. B. Fogo, and M. D. Breyer Serial determination of glomerular filtration rate in conscious mice using FITC-inulin clearance Am J Physiol Renal Physiol, March 1, 2004; 286(3): F590 - F596. [Abstract] [Full Text] |
||||
![]() |
G. Crambert and K. Geering FXYD Proteins: New Tissue-Specific Regulators of the Ubiquitous Na,K-ATPase Sci. Signal., January 21, 2003; 2003(166): re1 - re1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |